Human VASH1(Vasohibin 1) ELISA Kit

Human VASH1(Vasohibin 1) ELISA Kit

Human Vasohibin-1(VASH1) ELISA kit
1-CSB-EL025794HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasohibin-1(VASH1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasohibin 1 ELISA Kit (VASH1)
RK02485	Abclonal	96 Tests	EUR 521

Human Vasohibin 1(VASH1)ELISA Kit
QY-E00682	Qayee Biotechnology	96T	EUR 361

Human Vasohibin 1 (VASH1) ELISA Kit
SEG904Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit
SEG904Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit
SEG904Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit
SEG904Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit
4-SEG904Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vasohibin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasohibin 1 (VASH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Vasohibin- 1, Vash1 ELISA KIT
ELI-39841m	Lifescience Market	96 Tests	EUR 865

Mouse Vasohibin 1 (VASH1) ELISA Kit
20-abx258613	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Vasohibin 1 (VASH1) ELISA Kit
SEG904Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit
SEG904Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit
SEG904Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit
SEG904Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit
4-SEG904Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vasohibin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Vasohibin 1 (VASH1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Vasohibin-1 (VASH1) Antibody
20-abx004703	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody
20-abx015198	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody
20-abx307848	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody
20-abx327890	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody
abx219304-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody
abx331225-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody
abx239373-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Vasohibin 1 (VASH1) Antibody
20-abx211730	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody
20-abx211731	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human VASH1 (Vasohibin 1)
ELK5372	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasohibin 1 (VASH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasohibin 1 (V Show more
Description: A sandwich ELISA kit for detection of Vasohibin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)
KTE60073-48T	Abbkine	48T	EUR 332
Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)
KTE60073-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)
KTE60073-96T	Abbkine	96T	EUR 539
Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Vasohibin 1 (VASH1) CLIA Kit
20-abx495322	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse VASH1 (Vasohibin 1)
ELK7626	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasohibin 1 (VASH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasohibin 1 (V Show more
Description: A sandwich ELISA kit for detection of Vasohibin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)
KTE70031-48T	Abbkine	48T	EUR 332
VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)
KTE70031-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)
KTE70031-96T	Abbkine	96T	EUR 539
VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Vasohibin 1 (VASH1) CLIA Kit
20-abx495323	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Vasohibin-1 (VASH1) Antibody (HRP)
20-abx307849	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody (FITC)
20-abx307850	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody (Biotin)
20-abx307851	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-VASH1/Vasohibin Antibody
A04402	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal VASH1/Vasohibin Antibody. Validated in WB and tested in Human.

Polyclonal Vasohibin 1 / VASH1 Antibody (C-Terminus)
APR03230G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vasohibin 1 / VASH1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Vasohibin 1 ELISA kit
E01V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vasohibin 1 ELISA kit
E01V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vasohibin 1 ELISA kit
E01V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Vasohibin Antibody
A04402-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Vasohibin Antibody (VASH1) detection. Tested with WB in Human, Mouse, Rat.

VASH1 ELISA KIT|Human
EF004177	Lifescience Market	96 Tests	EUR 689

Mouse Vasohibin 1 ELISA kit
E03V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vasohibin 1 ELISA kit
E03V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vasohibin 1 ELISA kit
E03V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit
E02V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit
E02V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit
E02V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit
E04V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit
E04V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit
E04V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit
E07V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit
E07V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit
E07V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit
E08V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit
E08V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit
E08V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit
E06V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit
E06V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit
E06V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit
E09V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit
E09V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit
E09V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vasohibin 1 ELISA kit
E05V0412-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vasohibin 1 ELISA kit
E05V0412-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vasohibin 1 ELISA kit
E05V0412-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Vasohibin-1 Antibody
20-abx116595	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vasohibin 1 antibody
70R-3105	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Vasohibin 1 antibody raised against the middle region of VASH1

Vasohibin 1 antibody
70R-2056	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Vasohibin 1 antibody raised against the N terminal of VASH1

Human VASH2(Vasohibin-2) ELISA Kit
EH13543	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Vasohibin- 2, VASH2 ELISA KIT
ELI-51619h	Lifescience Market	96 Tests	EUR 824

Human Vasohibin-2 (VASH2) ELISA Kit
abx384217-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Vasohibin 2(VASH2)ELISA Kit
QY-E00681	Qayee Biotechnology	96T	EUR 361

Vasohibin 1 Polyclonal Antibody
20-abx116954	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vasohibin 1 Blocking Peptide
33R-1576	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VASH1 antibody, catalog no. 70R-2056

Vasohibin 1 Blocking Peptide
33R-8923	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VASH1 antibody, catalog no. 70R-3105

Mouse Vasohibin- 2, Vash2 ELISA KIT
ELI-17465m	Lifescience Market	96 Tests	EUR 865

VASH1 siRNA
20-abx939336	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASH1 siRNA
20-abx939337	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASH1 antibody
70R-21239	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VASH1 antibody

VASH1 Antibody
ABD4822	Lifescience Market	100 ug	EUR 438

VASH1 Antibody
35319-100ul	SAB	100ul	EUR 252

VASH1 Antibody
35319-50ul	SAB	50ul	EUR 187

VASH1 Antibody
42827-100ul	SAB	100ul	EUR 252

VASH1 Antibody
33108-100ul	SAB	100ul	EUR 252

VASH1 Antibody
25310-100ul	SAB	100ul	EUR 390

VASH1 Antibody
DF4822	Affbiotech	200ul	EUR 304
Description: VASH1 Antibody detects endogenous levels of total VASH1.

VASH1 Antibody
1-CSB-PA899191	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

VASH1 Antibody
1-CSB-PA004420	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

VASH1 Antibody
1-CSB-PA562311	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

VASH1 Antibody
1-CSB-PA745337GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

VASH1 Antibody
1-CSB-PA745337HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

VASH1 Antibody
CSB-PA149592-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

VASH1 Antibody
CSB-PA149592-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

VASH1 Antibody
1-CSB-PA025794GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-VASH1
YF-PA17632	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to VASH1

anti-VASH1
YF-PA17633	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to VASH1

anti-VASH1
YF-PA25801	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to VASH1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Human Vasohibin-2 (VASH2)
1-CSB-EP769783HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 56.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Vasohibin-2(VASH2) expressed in E.coli

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human VASH1 shRNA Plasmid
20-abx957808	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

VASH1 Recombinant Protein (Human)
RP034240	ABM	100 ug	Ask for price

VASH1 Recombinant Protein (Human)
RP034243	ABM	100 ug	Ask for price

VASH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2605702	ABM	1.0 ug DNA	EUR 154

Vasohibin Polyclonal Antibody
ES3685-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Vasohibin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Vasohibin Polyclonal Antibody
ES3685-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Vasohibin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Vasohibin 2 Antibody
20-abx116594	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vasohibin Polyclonal Antibody
ABP52686-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310 Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Vasohibin Polyclonal Antibody
ABP52686-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310 Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Vasohibin Polyclonal Antibody
ABP52686-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310 Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Anti-Vasohibin antibody
STJ96218	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Vasohibin.

VASH1 Conjugated Antibody
C42827	SAB	100ul	EUR 397

Polyclonal VASH1 Antibody
APR05462G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASH1 . This antibody is tested and proven to work in the following applications:

Polyclonal VASH1 Antibody
APR06708G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASH1 . This antibody is tested and proven to work in the following applications:

VASH1 Conjugated Antibody
C33108	SAB	100ul	EUR 397

anti- VASH1 antibody
FNab09373	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 Immunogen: vasohibin 1 Uniprot ID: Q7L8A9 Gene ID: 22846 Research Area: Cardiovascular
Description: Antibody raised against VASH1

VASH1 Rabbit pAb
A12569-100ul	Abclonal	100 ul	EUR 308

VASH1 Rabbit pAb
A12569-200ul	Abclonal	200 ul	EUR 459

VASH1 Rabbit pAb
A12569-20ul	Abclonal	20 ul	EUR 183

VASH1 Rabbit pAb
A12569-50ul	Abclonal	50 ul	EUR 223

VASH1 Rabbit pAb
A6148-100ul	Abclonal	100 ul	EUR 308

VASH1 Rabbit pAb
A6148-200ul	Abclonal	200 ul	EUR 459

VASH1 Rabbit pAb
A6148-20ul	Abclonal	20 ul	EUR 183

VASH1 Rabbit pAb
A6148-50ul	Abclonal	50 ul	EUR 223

VASH1 Polyclonal Antibody
A57185	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

VASH1 Blocking Peptide
DF4822-BP	Affbiotech	1mg	EUR 195

VASH1 cloning plasmid
CSB-CL745337HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 615 Sequence: atgccaggggggaagaaggtggctgggggtggcagcagcggtgccactccaacgtccgctgcggccaccgccccctctggggtcaggcgtttggagaccagcgaaggaacctcagcccagagagatgaggagccagaagaggaaggggaagaggacctgcgagacggaggcgtccc Show more
Description: A cloning plasmid for the VASH1 gene.

VASH1 cloning plasmid
CSB-CL745337HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1098 Sequence: atgccaggggggaagaaggtggctgggggtggcagcagcggtgccactccaacgtccgctgcggccaccgccccctctggggtcaggcgtttggagaccagcgaaggaacctcagcccagagagatgaggagccagaagaggaaggggaagaggacctgcgagacggaggcgtcc Show more
Description: A cloning plasmid for the VASH1 gene.

Anti-VASH1 antibody
PAab09373	Lifescience Market	100 ug	EUR 386

pENTR223-VASH1 vector
PVT11865	Lifescience Market	2 ug	EUR 304

pCMV-SPORT6-VASH1
PVT12951	Lifescience Market	2 ug	EUR 391

Anti-VASH1 antibody
STJ27901	St John's Laboratory	100 µl	EUR 277

Anti-VASH1 antibody
STJ114443	St John's Laboratory	100 µl	EUR 277

Anti-VASH1 (4A3)
YF-MA11369	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VASH1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human VASH1(Vasohibin 1) ELISA Kit