Human VASH1(Vasohibin 1) ELISA Kit

Human Vasohibin-1(VASH1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasohibin-1(VASH1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasohibin 1 ELISA Kit (VASH1)

RK02485 96 Tests
EUR 521

Human Vasohibin 1(VASH1)ELISA Kit

QY-E00682 96T
EUR 361

Human Vasohibin 1 (VASH1) ELISA Kit

SEG904Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit

SEG904Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit

SEG904Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit

SEG904Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasohibin 1 (VASH1) in tissue homogenates, cell lysates and other biological fluids.

Human Vasohibin 1 (VASH1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasohibin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasohibin 1 (VASH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Vasohibin- 1, Vash1 ELISA KIT

ELI-39841m 96 Tests
EUR 865

Mouse Vasohibin 1 (VASH1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Vasohibin 1 (VASH1) ELISA Kit

SEG904Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit

SEG904Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit

SEG904Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit

SEG904Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasohibin 1 (VASH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasohibin 1 (VASH1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Vasohibin 1 (VASH1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasohibin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Vasohibin 1 (VASH1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Vasohibin-1 (VASH1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody

abx219304-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody

abx331225-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody

abx239373-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Vasohibin 1 (VASH1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vasohibin 1 (VASH1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human VASH1 (Vasohibin 1)

ELK5372 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasohibin 1 (VASH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasohibin 1 (V
  • Show more
Description: A sandwich ELISA kit for detection of Vasohibin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)

KTE60073-48T 48T
EUR 332
  • Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)

KTE60073-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasohibin-1 (VASH1)

KTE60073-96T 96T
EUR 539
  • Vasohibin protein contains a cluster of basic amino acids in its C terminus and no classic secretion signal sequence. Vasohibin expression was robust between embryonic weeks 6 to 12 in heart, brain, kidney, lung, skeletal muscle, and whole embryo. Im
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Vasohibin 1 (VASH1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse VASH1 (Vasohibin 1)

ELK7626 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasohibin 1 (VASH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasohibin 1 (V
  • Show more
Description: A sandwich ELISA kit for detection of Vasohibin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)

KTE70031-48T 48T
EUR 332
  • VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)

KTE70031-5platesof96wells 5 plates of 96 wells
EUR 2115
  • VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasohibin-1 (VASH1)

KTE70031-96T 96T
EUR 539
  • VASH2 deduced 355-amino acid protein shares 52.5% amino acid identity with VASH1 and 97.5% amino acid identity with mouse Vash2. VASH2 expression at embryonic weeks 6 to 12 in human heart, brain, kidney, lung, muscle, and whole embryo. RT-PCR analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasohibin-1 (VASH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Vasohibin 1 (VASH1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Vasohibin-1 (VASH1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vasohibin-1 (VASH1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-VASH1/Vasohibin Antibody

A04402 100ul
EUR 397
Description: Rabbit Polyclonal VASH1/Vasohibin Antibody. Validated in WB and tested in Human.

Polyclonal Vasohibin 1 / VASH1 Antibody (C-Terminus)

APR03230G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vasohibin 1 / VASH1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Vasohibin 1 ELISA kit

E01V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vasohibin 1 ELISA kit

E01V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vasohibin 1 ELISA kit

E01V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Vasohibin Antibody

A04402-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vasohibin Antibody (VASH1) detection. Tested with WB in Human, Mouse, Rat.


EF004177 96 Tests
EUR 689

Mouse Vasohibin 1 ELISA kit

E03V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vasohibin 1 ELISA kit

E03V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vasohibin 1 ELISA kit

E03V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit

E02V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit

E02V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vasohibin 1 ELISA kit

E02V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit

E04V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit

E04V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vasohibin 1 ELISA kit

E04V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit

E07V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit

E07V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vasohibin 1 ELISA kit

E07V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit

E08V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit

E08V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vasohibin 1 ELISA kit

E08V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit

E06V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit

E06V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vasohibin 1 ELISA kit

E06V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit

E09V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit

E09V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vasohibin 1 ELISA kit

E09V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

VASH1 ELISA Kit (Human) (OKCD01934)

OKCD01934 96 Wells
EUR 831
Description: Description of target: Angiogenesis inhibitor. Inhibits migration, proliferation and network formation by endothelial cells as well as angiogenesis. This inhibitory effect is selective to endothelial cells as it does not affect the migration of smooth muscle cells or fibroblasts. Does not affect the proliferation of cancer cells in vitro, but inhibits tumor growth and tumor angiogenesis. Acts in an autocrine manner. Inhibits artery neointimal formation and macrophage infiltration. Exhibits heparin-binding activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.255 ng/mL

VASH1 ELISA Kit (Human) (OKAN06304)

OKAN06304 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.224 ng/mL

VASH1 ELISA Kit (Human) (OKCA02154)

OKCA02154 96 Wells
EUR 833
Description: Description of target: Angiogenesis inhibitor. Inhibits migration, proliferation and network formation by endothelial cells as well as angiogenesis. This inhibitory effect is selective to endothelial cells as it does not affect the migration of smooth muscle cells or fibroblasts. Does not affect the proliferation of cancer cells in vitro, but inhibits tumor growth and tumor angiogenesis. Acts in an autocrine manner. Inhibits artery neointimal formation and macrophage infiltration. Exhibits heparin-binding activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Guinea pig Vasohibin 1 ELISA kit

E05V0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vasohibin 1 ELISA kit

E05V0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vasohibin 1 ELISA kit

E05V0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vasohibin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Vasohibin-1 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vasohibin 1 antibody

70R-3105 50 ug
EUR 467
Description: Rabbit polyclonal Vasohibin 1 antibody raised against the middle region of VASH1

Vasohibin 1 antibody

70R-2056 50 ug
EUR 467
Description: Rabbit polyclonal Vasohibin 1 antibody raised against the N terminal of VASH1

Human VASH2(Vasohibin-2) ELISA Kit

EH13543 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Vasohibin- 2, VASH2 ELISA KIT

ELI-51619h 96 Tests
EUR 824

Human Vasohibin-2 (VASH2) ELISA Kit

abx384217-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Vasohibin 2(VASH2)ELISA Kit

QY-E00681 96T
EUR 361

Vash1 ELISA Kit (Mouse) (OKCD01935)

OKCD01935 96 Wells
EUR 857
Description: Description of target: Angiogenesis inhibitor. Inhibits migration, proliferation and network formation by endothelial cells as well as angiogenesis. This inhibitory effect is selective to endothelial cells as it does not affect the migration of smooth muscle cells or fibroblasts. Does not affect the proliferation of cancer cells in vitro, but inhibits tumor growth and tumor angiogenesis. Acts in an autocrine manner. Inhibits artery neointimal formation and macrophage infiltration. Exhibits heparin-binding activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.29 ng/mL

Vasohibin 1 Polyclonal Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vasohibin 1 Blocking Peptide

33R-1576 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VASH1 antibody, catalog no. 70R-2056

Vasohibin 1 Blocking Peptide

33R-8923 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VASH1 antibody, catalog no. 70R-3105

Mouse Vasohibin- 2, Vash2 ELISA KIT

ELI-17465m 96 Tests
EUR 865


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VASH1 antibody

70R-21239 50 ul
EUR 435
Description: Rabbit polyclonal VASH1 antibody

VASH1 Antibody

ABD4822 100 ug
EUR 438

VASH1 Antibody

35319-100ul 100ul
EUR 252

VASH1 Antibody

35319-50ul 50ul
EUR 187

VASH1 Antibody

42827-100ul 100ul
EUR 252

VASH1 Antibody

33108-100ul 100ul
EUR 252

VASH1 Antibody

25310-100ul 100ul
EUR 390

VASH1 Antibody

DF4822 200ul
EUR 304
Description: VASH1 Antibody detects endogenous levels of total VASH1.

VASH1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

VASH1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

VASH1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

VASH1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

VASH1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

VASH1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

VASH1 Antibody

CSB-PA149592-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

VASH1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VASH1. Recognizes VASH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


YF-PA17632 50 ul
EUR 363
Description: Mouse polyclonal to VASH1


YF-PA17633 50 ug
EUR 363
Description: Mouse polyclonal to VASH1


YF-PA25801 50 ul
EUR 334
Description: Mouse polyclonal to VASH1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human Vasohibin-2 (VASH2)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Vasohibin-2(VASH2) expressed in E.coli

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human VASH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VASH1 Recombinant Protein (Human)

RP034240 100 ug Ask for price

VASH1 Recombinant Protein (Human)

RP034243 100 ug Ask for price

VASH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2605702 1.0 ug DNA
EUR 154

Vasohibin Polyclonal Antibody

ES3685-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Vasohibin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Vasohibin Polyclonal Antibody

ES3685-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Vasohibin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Vasohibin 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vasohibin Polyclonal Antibody

ABP52686-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Vasohibin Polyclonal Antibody

ABP52686-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Vasohibin Polyclonal Antibody

ABP52686-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of Vasohibin from Human, Mouse, Rat. This Vasohibin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Vasohibin at AA range: 230-310

Anti-Vasohibin antibody

STJ96218 200 µl
EUR 197
Description: Rabbit polyclonal to Vasohibin.

VASH1 Conjugated Antibody

C42827 100ul
EUR 397

Polyclonal VASH1 Antibody

APR05462G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASH1 . This antibody is tested and proven to work in the following applications:

Polyclonal VASH1 Antibody

APR06708G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VASH1 . This antibody is tested and proven to work in the following applications:

VASH1 Conjugated Antibody

C33108 100ul
EUR 397

anti- VASH1 antibody

FNab09373 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: vasohibin 1
  • Uniprot ID: Q7L8A9
  • Gene ID: 22846
  • Research Area: Cardiovascular
Description: Antibody raised against VASH1

VASH1 Rabbit pAb

A12569-100ul 100 ul
EUR 308

VASH1 Rabbit pAb

A12569-200ul 200 ul
EUR 459

VASH1 Rabbit pAb

A12569-20ul 20 ul
EUR 183

VASH1 Rabbit pAb

A12569-50ul 50 ul
EUR 223

VASH1 Rabbit pAb

A6148-100ul 100 ul
EUR 308

VASH1 Rabbit pAb

A6148-200ul 200 ul
EUR 459

VASH1 Rabbit pAb

A6148-20ul 20 ul
EUR 183

VASH1 Rabbit pAb

A6148-50ul 50 ul
EUR 223

VASH1 Polyclonal Antibody

A57185 100 µg
EUR 570.55
Description: Ask the seller for details

VASH1 Blocking Peptide

DF4822-BP 1mg
EUR 195

VASH1 cloning plasmid

CSB-CL745337HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 615
  • Sequence: atgccaggggggaagaaggtggctgggggtggcagcagcggtgccactccaacgtccgctgcggccaccgccccctctggggtcaggcgtttggagaccagcgaaggaacctcagcccagagagatgaggagccagaagaggaaggggaagaggacctgcgagacggaggcgtccc
  • Show more
Description: A cloning plasmid for the VASH1 gene.

VASH1 cloning plasmid

CSB-CL745337HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atgccaggggggaagaaggtggctgggggtggcagcagcggtgccactccaacgtccgctgcggccaccgccccctctggggtcaggcgtttggagaccagcgaaggaacctcagcccagagagatgaggagccagaagaggaaggggaagaggacctgcgagacggaggcgtcc
  • Show more
Description: A cloning plasmid for the VASH1 gene.

Anti-VASH1 antibody

PAab09373 100 ug
EUR 386

pENTR223-VASH1 vector

PVT11865 2 ug
EUR 304


PVT12951 2 ug
EUR 391

Human VASH1(Vasohibin 1) ELISA Kit