Human LPIN1(Lipin 1) ELISA Kit

Human LPIN1(Lipin 1) ELISA Kit

Rat Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Ra-48T 48T
EUR 549
  • Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Ra-96T 96T
EUR 718
  • Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Mu-48Tests 48 Tests
EUR 533

Mouse Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Mu-96Tests 96 Tests
EUR 740

Rat Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Ra-48Tests 48 Tests
EUR 557

Rat Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Ra-96Tests 96 Tests
EUR 775

Mouse Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Mu-48Tests 48 Tests
EUR 557

Mouse Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Mu-96Tests 96 Tests
EUR 774

Rat Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Ra-48Tests 48 Tests
EUR 583

Rat Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Ra-96Tests 96 Tests
EUR 811

Lipin 1 (LPIN1)

RA25079 100 ul
EUR 461

Human Lipin 1 (LPIN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lipin 1(LPIN1)ELISA Kit

QY-E00226 96T
EUR 361

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Lipin 1 (LPIN1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Lipin 1 (LPIN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lipin 1 (LPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Lipin 1 (LPIN1) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipin 1 (LPIN1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipin 1 (LPIN1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipin 1 (LPIN1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lipin 1 (LPIN1) Antibody

abx431255-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ELISA kit for Human LPIN1 (Lipin 1)

ELK5420 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Lipin 1 (LPIN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat LPIN1 (Lipin 1)

ELK6423 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse LPIN1 (Lipin 1)

ELK6460 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Lipin 1 (LPIN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Lipin 1 (LPIN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Lipin 1 (LPIN1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Lipin 1 (LPIN1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Lipin 1 (LPIN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Polyclonal LPIN1 / Lipin 1 Antibody (C-Terminus)

APR08260G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 / Lipin 1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Phosphatidate phosphatase LPIN1, LPIN1 ELISA KIT

ELI-42202h 96 Tests
EUR 824

Human Lipin ELISA kit

E01L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipin ELISA kit

E01L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipin ELISA kit

E01L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EF005209 96 Tests
EUR 689

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-48T 48T
EUR 332
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-96T 96T
EUR 539
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Phosphatidate phosphatase LPIN1, Lpin1 ELISA KIT

ELI-12626m 96 Tests
EUR 865

Rat Lipin ELISA kit

E02L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Lipin ELISA kit

E02L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Lipin ELISA kit

E02L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit

E03L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit

E03L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit

E03L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit

E04L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit

E04L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit

E04L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit

E08L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit

E08L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit

E08L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit

E07L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit

E07L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit

E07L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit

E06L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit

E06L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit

E06L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit

E09L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit

E09L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit

E09L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

LPIN1 ELISA Kit (Human) (OKCD04380)

OKCD04380 96 Wells
EUR 831
Description: Description of target: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.43 ng/mL

Lipin 1 antibody

70R-3204 50 ug
EUR 467
Description: Rabbit polyclonal Lipin 1 antibody raised against the N terminal of LPIN1

Lipin 1 Antibody

49921-100ul 100ul
EUR 333

Lipin 1 Antibody

49921-50ul 50ul
EUR 239

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-48T 48T
EUR 332
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-96T 96T
EUR 539
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Lpin1 ELISA Kit| Mouse Phosphatidate phosphatase LPIN1 ELISA Ki

EF015392 96 Tests
EUR 689

Human Lipin 2 (LPIN2) ELISA Kit

abx388300-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lipin 3(LPIN3)ELISA Kit

QY-E00224 96T
EUR 361

Human Lipin 2(LPIN2)ELISA Kit

QY-E00225 96T
EUR 361

Guinea pig Lipin ELISA kit

E05L0546-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Lipin ELISA kit

E05L0546-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Lipin ELISA kit

E05L0546-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Lipin 1 Conjugated Antibody

C49921 100ul
EUR 397

Lipin 1 Blocking Peptide

33R-8579 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LPIN1 antibody, catalog no. 70R-3204

Anti-Lipin 1 (3D9)

YF-MA17815 100 ug
EUR 363
Description: Mouse monoclonal to Lipin 1

LPIN1 ELISA Kit (Rat) (OKCD04508)

OKCD04508 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

LPIN1 ELISA Kit (Mouse) (OKCD08947)

OKCD08947 96 Wells
EUR 1001
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. Acts also as nuclear transcriptional coactivator for PPARGC1A/PPARA regulatory pathway to modulate lipid metabolism gene expression. Is involved in adipocyte differentiation. Isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL

LPIN1 ELISA Kit (Mouse) (OKDD00738)

OKDD00738 96 Wells
EUR 988
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. acts also as nuclear transcriptional coactivator for ppargc1a/ppara regulatory pathway to modulate lipid metabolism gene expression. is involved in adipocyte differentiation. isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

abx038051-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LPIN1 Antibody

AF7585 200ul
EUR 376
Description: LPIN1 Antibody detects endogenous levels of LPIN1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LPIN1 Antibody

ABD7924 100 ug
EUR 438

LPIN1 Antibody

39971-100ul 100ul
EUR 390

LPIN1 Antibody

47149-100ul 100ul
EUR 252

LPIN1 Antibody

DF7924 200ul
EUR 304
Description: LPIN1 Antibody detects endogenous levels of total LPIN1.

LPIN1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LPIN1. Recognizes LPIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Anti-Lipin 1 (Internal) antibody

STJ71014 100 µg
EUR 260

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human LPIN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Lipin 3 Antibody

abx432932-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Lipin 2 Antibody

EUR 316

Lipin 2 Antibody

EUR 146

Lipin 2 antibody

70R-12128 100 ug
EUR 403
Description: Rabbit polyclonal Lipin 2 antibody

LPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1227102 1.0 ug DNA
EUR 154

Monoclonal Lipin-1 Antibody, Clone: EPR3725

APR08236G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Lipin-1. The antibodies are raised in Rabbit and are from clone EPR3725. This antibody is applicable in WB, IHC and IF

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Polyclonal LPIN1 Antibody

APR08261G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 . This antibody is tested and proven to work in the following applications:

LPIN1 Conjugated Antibody

C47149 100ul
EUR 397

LPIN1 Blocking Peptide

AF7585-BP 1mg
EUR 195

LPIN1 cloning plasmid

CSB-CL614805HU-10ug 10ug
EUR 859
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2673
  • Sequence: atgaattacgtggggcagttagccggccaggtgtttgtcaccgtgaaggagctctacaaggggctgaatcccgccacactctcagggtgcattgacatcattgtcatccgccagcccaatggaaacctccaatgctcccctttccacgtccgctttgggaagatgggggtcctgc
  • Show more
Description: A cloning plasmid for the LPIN1 gene.

LPIN1 Polyclonal Antibody

ES10897-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPIN1 Polyclonal Antibody

ES10897-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPIN1 Polyclonal Antibody

ABP59136-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody

ABP59136-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody

ABP59136-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Rabbit pAb

A14111-100ul 100 ul
EUR 308

LPIN1 Rabbit pAb

A14111-200ul 200 ul
EUR 459

LPIN1 Rabbit pAb

A14111-20ul 20 ul
EUR 183

LPIN1 Rabbit pAb

A14111-50ul 50 ul
EUR 223

LPIN1 Rabbit pAb

A8486-100ul 100 ul
EUR 308

LPIN1 Rabbit pAb

A8486-200ul 200 ul
EUR 459

LPIN1 Rabbit pAb

A8486-20ul 20 ul
EUR 183

LPIN1 Rabbit pAb

A8486-50ul 50 ul
EUR 223

LPIN1 Blocking Peptide

DF7924-BP 1mg
EUR 195

Anti-LPIN1 antibody

STJ110784 100 µl
EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

Anti-LPIN1 antibody

STJ192055 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LPIN1

Anti-LPIN1 antibody

STJ116046 100 µl
EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

LPIN1 ORF Vector (Human) (pORF)

ORF006053 1.0 ug DNA
EUR 95


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Polyclonal Lipin 2 Antibody

APR00210G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Lipin 2 . This antibody is tested and proven to work in the following applications:

Lipin 2 (LPIN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody

abx034008-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody

abx034008-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody

abx432931-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Lipin 2 (LPIN2) Antibody

abx234830-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Lipin 2 Blocking Peptide

33R-10945 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Lipin 2 antibody, catalog no. 70R-12128

Lipin 2 Blocking Peptide

EUR 153

Anti-Lipin 2 antibody

STJ70666 100 µg
EUR 260

Anti-Lipin 3 antibody

STJ71015 100 µg
EUR 359

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal Lipin 1 (Internal) Antibody (internal region)

APR08234G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Lipin 1 (Internal) (internal region). This antibody is tested and proven to work in the following applications:

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Phospho-LPIN1(Thr14) Antibody

AF7085 200ul
EUR 376
Description: Phospho-LPIN1(Thr14) Antibody detects endogenous levels of LPIN1 only when phosphorylated at Thr14.

LPIN1 (Phospho-Thr14) Antibody

12950-100ul 100ul
EUR 252

LPIN1 (Phospho-Thr14) Antibody

12950-50ul 50ul
EUR 187

Mouse LPIN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5026902 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7617902 1.0 ug DNA
EUR 154

LPIN1 sgRNA CRISPR Lentivector set (Human)

K1227101 3 x 1.0 ug
EUR 339

Rabbit Anti-Mouse Lipin-1 IgG #1, Aff. Pure

LPN11-A 100 ug
EUR 482

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

EP1100-1 96 Well Plate
EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human LPIN1(Lipin 1) ELISA Kit