Human FNTb(Farnesyltransferase Beta) ELISA Kit

Human FNTb(Farnesyltransferase Beta) ELISA Kit

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

SEJ090Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB
  • CAAX farnesyltransferase subunit beta
  • Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx031594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx031594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx029024-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx029024-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody

abx233181-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Farnesyltransferase Beta (FNTb) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human FNTb (Farnesyltransferase Beta)

ELK5384 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Beta (FNTB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT

ELI-32519h 96 Tests
EUR 824

Mouse Protein farnesyltransferase subunit beta, Fntb ELISA KIT

ELI-12899m 96 Tests
EUR 865

Bovine Protein farnesyltransferase subunit beta, FNTB ELISA KIT

ELI-30850b 96 Tests
EUR 928

Fntb/ Rat Fntb ELISA Kit

ELI-38341r 96 Tests
EUR 886


EF009666 96 Tests
EUR 689

FNTB ELISA Kit (Human) (OKCD01981)

OKCD01981 96 Wells
EUR 831
Description: Description of target: Essential subunit of the farnesyltransferase complex. Catalyzes the transfer of a farnesyl moiety from farnesyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL

Human Farnesyltransferase alpha (FNTa) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Farnesyltransferase Alpha(FNTa)ELISA Kit

QY-E03678 96T
EUR 361

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

SEG487Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA
  • PTAR2
  • PGGT1A
  • Protein Prenyltransferase Alpha Subunit Repeat Containing 2
  • CAAX farnesyltransferase subunit alpha
  • Ras proteins prenyltransferase subun
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E01F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)

ELK4902 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F
  • Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FNTB antibody

70R-51542 100 ul
EUR 244
Description: Purified Polyclonal FNTB antibody

FNTB Antibody

ABD13103 100 ug
EUR 438

FNTB Antibody

ABD4339 100 ug
EUR 438

FNTB Antibody

47302-100ul 100ul
EUR 252

FNTB Antibody

49018-100ul 100ul
EUR 333

FNTB Antibody

49018-50ul 50ul
EUR 239

FNTB Antibody

47875-100ul 100ul
EUR 252

FNTB antibody

70R-17340 50 ul
EUR 435
Description: Rabbit polyclonal FNTB antibody

FNTB Antibody

DF4339 200ul
EUR 304
Description: FNTB Antibody detects endogenous levels of total FNTB.

FNTB Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

FNTB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FNTB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

Human FNTB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FNTB Recombinant Protein (Human)

RP012427 100 ug Ask for price

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit

EH3056 96T
EUR 524.1
  • Detection range: 1.563-100mIU/ml
  • Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-48T 48T
EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

GA-E0768HM-96T 96T
EUR 466

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx252452-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit

201-12-0752 96 tests
EUR 440
  • This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit

QY-E03679 96T
EUR 361

Human Farnesyltransferase alpha (FNTa) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E06F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E02F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E03F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E04F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E08F0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E09F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E07F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTB Conjugated Antibody

C47302 100ul
EUR 397

FNTB Conjugated Antibody

C49018 100ul
EUR 397

FNTB cloning plasmid

CSB-CL008780HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1314
  • Sequence: atggcttctccgagttctttcacctactattgccctccatcttcctcccccgtctggtcagagccgctgtacagtctgaggcccgagcacgcgcgagagcggttgcaggacgactcggtggaaacagtcacgtccatagaacaggcaaaagtagaagaaaagatccaagaggtct
  • Show more
Description: A cloning plasmid for the FNTB gene.

anti- FNTB antibody

FNab03181 100µg
EUR 505.25
  • Immunogen: farnesyltransferase, CAAX box, beta
  • Uniprot ID: P49356
  • Gene ID: 2342
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against FNTB

FNTB Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-FNTB Antibody

A07620 100ul
EUR 397
Description: Rabbit Polyclonal FNTB Antibody. Validated in WB and tested in Human, Mouse, Rat.

FNTB Polyclonal Antibody

A62606 100 µg
EUR 570.55
Description: The best epigenetics products

FNTB Rabbit pAb

A15671-100ul 100 ul
EUR 308

FNTB Rabbit pAb

A15671-200ul 200 ul
EUR 459

FNTB Rabbit pAb

A15671-20ul 20 ul
EUR 183

FNTB Rabbit pAb

A15671-50ul 50 ul
EUR 223

FNTB Rabbit pAb

A8717-100ul 100 ul
EUR 308

FNTB Rabbit pAb

A8717-200ul 200 ul
EUR 459

FNTB Rabbit pAb

A8717-20ul 20 ul Ask for price

FNTB Rabbit pAb

A8717-50ul 50 ul Ask for price

FNTB Blocking Peptide

DF4339-BP 1mg
EUR 195

Anti-FNTB antibody

PAab03181 100 ug
EUR 355

Anti-FNTB antibody

STJ111385 100 µl
EUR 277

Anti-FNTB antibody

STJ118131 100 µl
EUR 277

Anti-FNTB (3A9)

YF-MA13102 100 ug
EUR 363
Description: Mouse monoclonal to FNTB

ELISA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)

E-EL-H1250 1 plate of 96 wells
EUR 534
  • Gentaur's FDFT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

FNTB ORF Vector (Human) (pORF)

ORF004143 1.0 ug DNA
EUR 95

CHURC1-FNTB Recombinant Protein (Human)

RP052156 100 ug Ask for price

Human Farnesyltransferase Alpha (FNTa) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx359694-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx361477-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx362487-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit

E05F0213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sheep Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx364435-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx356427-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human farnesyl- diphosphate farnesyltransferase 1, FDFT1 ELISA K

ELA-E1708h 96 Tests
EUR 824

Human Farnesyl Diphosphate Farnesyltransferase 1 (fFDFT1) CLIA Kit

abx196646-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse FNTB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FNTB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FNTB recombinant monoclonal antibody

A5331 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human FNTB for WB,ELISA

FNTB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FNTB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FNTB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FNTB Recombinant Protein (Rat)

RP201629 100 ug Ask for price

FNTB Recombinant Protein (Mouse)

RP134966 100 ug Ask for price

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031598-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody

abx031599-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody

abx233180-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49354
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.7KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

FNTB sgRNA CRISPR Lentivector set (Human)

K0793101 3 x 1.0 ug
EUR 339

CHURC1-FNTB ORF Vector (Human) (pORF)

ORF017386 1.0 ug DNA Ask for price

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit

abx357305-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CLIA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)

E-CL-H0810 1 plate of 96 wells
EUR 584
  • Gentaur's FDFT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Polyclonal FNTB Antibody (N-term)

AMM04575G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTB (N-term). This antibody is tested and proven to work in the following applications:

FNTB Polyclonal Antibody, HRP Conjugated

A62607 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human FNTb(Farnesyltransferase Beta) ELISA Kit