Human FNTb(Farnesyltransferase Beta) ELISA Kit

Human FNTb(Farnesyltransferase Beta) ELISA Kit

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
4-SEJ090Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB CAAX farnesyltransferase subunit beta Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Beta (FNTB) Antibody
20-abx124317	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx112467	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx007515	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx031594-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx031594-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx029024-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx029024-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx327827	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx302622	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx233181-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Human Farnesyltransferase Beta (FNTb) CLIA Kit
20-abx495613	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human FNTb (Farnesyltransferase Beta)
ELK5384	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Beta (FNTB) Antibody (HRP)
20-abx303881	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (FITC)
20-abx303882	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (Biotin)
20-abx303883	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT
ELI-32519h	Lifescience Market	96 Tests	EUR 824

Mouse Protein farnesyltransferase subunit beta, Fntb ELISA KIT
ELI-12899m	Lifescience Market	96 Tests	EUR 865

Bovine Protein farnesyltransferase subunit beta, FNTB ELISA KIT
ELI-30850b	Lifescience Market	96 Tests	EUR 928

Fntb/ Rat Fntb ELISA Kit
ELI-38341r	Lifescience Market	96 Tests	EUR 886

FNTB ELISA KIT|Human
EF009666	Lifescience Market	96 Tests	EUR 689

FNTB ELISA Kit (Human) (OKCD01981)
OKCD01981	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Essential subunit of the farnesyltransferase complex. Catalyzes the transfer of a farnesyl moiety from farnesyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL

Human Farnesyltransferase alpha (FNTa) ELISA Kit
20-abx151575	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Farnesyltransferase Alpha(FNTa)ELISA Kit
QY-E03678	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
4-SEG487Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA PTAR2 PGGT1A Protein Prenyltransferase Alpha Subunit Repeat Containing 2 CAAX farnesyltransferase subunit alpha Ras proteins prenyltransferase subun Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)
ELK4902	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

FNTB siRNA
20-abx901996	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTB siRNA
20-abx917057	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTB siRNA
20-abx917058	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTB antibody
70R-51542	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal FNTB antibody

FNTB Antibody
ABD13103	Lifescience Market	100 ug	EUR 438

FNTB Antibody
ABD4339	Lifescience Market	100 ug	EUR 438

FNTB Antibody
47302-100ul	SAB	100ul	EUR 252

FNTB Antibody
49018-100ul	SAB	100ul	EUR 333

FNTB Antibody
49018-50ul	SAB	50ul	EUR 239

FNTB Antibody
47875-100ul	SAB	100ul	EUR 252

FNTB antibody
70R-17340	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FNTB antibody

FNTB Antibody
DF4339	Affbiotech	200ul	EUR 304
Description: FNTB Antibody detects endogenous levels of total FNTB.

FNTB Antibody
1-CSB-PA008368	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

FNTB Antibody
1-CSB-PA008780GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FNTB Antibody
1-CSB-PA008780LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

Human FNTB shRNA Plasmid
20-abx951639	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FNTB Recombinant Protein (Human)
RP012427	ABM	100 ug	Ask for price

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit
EH3056	FN Test	96T	EUR 524.1
Detection range: 1.563-100mIU/ml Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-48T	GenAsia Biotech	48T	EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-96T	GenAsia Biotech	96T	EUR 466

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx252452-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit
201-12-0752	SunredBio	96 tests	EUR 440
This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
QY-E03679	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase alpha (FNTa) CLIA Kit
20-abx495216	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTB Conjugated Antibody
C47302	SAB	100ul	EUR 397

FNTB Conjugated Antibody
C49018	SAB	100ul	EUR 397

FNTB cloning plasmid
CSB-CL008780HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1314 Sequence: atggcttctccgagttctttcacctactattgccctccatcttcctcccccgtctggtcagagccgctgtacagtctgaggcccgagcacgcgcgagagcggttgcaggacgactcggtggaaacagtcacgtccatagaacaggcaaaagtagaagaaaagatccaagaggtct Show more
Description: A cloning plasmid for the FNTB gene.

anti- FNTB antibody
FNab03181	FN Test	100µg	EUR 505.25
Immunogen: farnesyltransferase, CAAX box, beta Uniprot ID: P49356 Gene ID: 2342 Research Area: Metabolism, Developmental biology
Description: Antibody raised against FNTB

FNTB Blocking Peptide
20-abx062117	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-FNTB Antibody
A07620	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal FNTB Antibody. Validated in WB and tested in Human, Mouse, Rat.

FNTB Polyclonal Antibody
A62606	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

FNTB Rabbit pAb
A15671-100ul	Abclonal	100 ul	EUR 308

FNTB Rabbit pAb
A15671-200ul	Abclonal	200 ul	EUR 459

FNTB Rabbit pAb
A15671-20ul	Abclonal	20 ul	EUR 183

FNTB Rabbit pAb
A15671-50ul	Abclonal	50 ul	EUR 223

FNTB Rabbit pAb
A8717-100ul	Abclonal	100 ul	EUR 308

FNTB Rabbit pAb
A8717-200ul	Abclonal	200 ul	EUR 459

FNTB Rabbit pAb
A8717-20ul	Abclonal	20 ul	Ask for price

FNTB Rabbit pAb
A8717-50ul	Abclonal	50 ul	Ask for price

FNTB Blocking Peptide
DF4339-BP	Affbiotech	1mg	EUR 195

Anti-FNTB antibody
PAab03181	Lifescience Market	100 ug	EUR 355

Anti-FNTB antibody
STJ111385	St John's Laboratory	100 µl	EUR 277

Anti-FNTB antibody
STJ118131	St John's Laboratory	100 µl	EUR 277

Anti-FNTB (3A9)
YF-MA13102	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FNTB

ELISA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)
E-EL-H1250	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FDFT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

FNTB ORF Vector (Human) (pORF)
ORF004143	ABM	1.0 ug DNA	EUR 95

CHURC1-FNTB Recombinant Protein (Human)
RP052156	ABM	100 ug	Ask for price

Human Farnesyltransferase Alpha (FNTa) Protein
20-abx166599	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx359694-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx361477-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx362487-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sheep Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx364435-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx356427-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human farnesyl- diphosphate farnesyltransferase 1, FDFT1 ELISA K
ELA-E1708h	Lifescience Market	96 Tests	EUR 824

Human Farnesyl Diphosphate Farnesyltransferase 1 (fFDFT1) CLIA Kit
abx196646-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse FNTB shRNA Plasmid
20-abx980087	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat FNTB shRNA Plasmid
20-abx986261	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FNTB recombinant monoclonal antibody
A5331	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human FNTB for WB,ELISA

FNTB Antibody, HRP conjugated
1-CSB-PA008780LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FNTB Antibody, FITC conjugated
1-CSB-PA008780LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FNTB Antibody, Biotin conjugated
1-CSB-PA008780LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FNTB. Recognizes FNTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FNTB Recombinant Protein (Rat)
RP201629	ABM	100 ug	Ask for price

FNTB Recombinant Protein (Mouse)
RP134966	ABM	100 ug	Ask for price

Farnesyltransferase Alpha (FNTA) Antibody
20-abx123732	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
20-abx112466	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx128216	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx172331	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody
abx233180-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)
4-RPG487Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49354 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.7KDa Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

FNTB sgRNA CRISPR Lentivector set (Human)
K0793101	ABM	3 x 1.0 ug	EUR 339

CHURC1-FNTB ORF Vector (Human) (pORF)
ORF017386	ABM	1.0 ug DNA	Ask for price

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx357305-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CLIA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)
E-CL-H0810	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's FDFT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Polyclonal FNTB Antibody (N-term)
AMM04575G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTB (N-term). This antibody is tested and proven to work in the following applications:

FNTB Polyclonal Antibody, HRP Conjugated
A62607	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Human FNTb(Farnesyltransferase Beta) ELISA Kit