Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit

Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit

Human Phosphatidylinositol Glycan L (PIGL) ELISA Kit

SEH399Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatidylinositol Glycan L (PIGL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatidylinositol Glycan L (PIGL) in tissue homogenates, cell lysates and other biological fluids.

Human Phosphatidylinositol Glycan L (PIGL) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phosphatidylinositol Glycan L elisa. Alternative names of the recognized antigen: N-Acetylglucosaminylphosphatidylinositol Deacetylase
  • Phosphatidylinositol Glycan Anchor Biosynthesis, Class L
  • N-acetylglucosaminyl-phosphatidylinositol
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatidylinositol Glycan L (PIGL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Phosphatidylinositol Glycan L (PIGL) Antibody

abx029109-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody

abx029109-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Phosphatidylinositol Glycan L (PIGL) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PIGL (Phosphatidylinositol Glycan L)

ELK5471 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phosphatidylinositol Glycan L (PIGL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phosphatidylinositol Glycan L from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Phosphatidylinositol Glycan L (PIGL) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Phosphatidylinositol Glycan, Class M (PIGM) ELISA Kit

abx382228-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan, Class S (PIGS) ELISA Kit

abx382231-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pigw ELISA Kit| Mouse Phosphatidylinositol-glycan biosynthesis

EF015848 96 Tests
EUR 689

PIGW ELISA Kit| Bovine Phosphatidylinositol-glycan biosynthesis

EF011744 96 Tests
EUR 689

Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx573546-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D

EK3272 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E1050Hu 1 Kit
EUR 605

Human GPLD1(Phosphatidylinositol-glycan-specific phospholipase D) ELISA Kit

EH1534 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P80108
  • Alias: GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1)/GPIPLD/GPIPLDM/PIGPLD/PIGPLD1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit

CSB-EL009721HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Gpld1 ELISA Kit| Rat Phosphatidylinositol-glycan-specific phosp

EF018760 96 Tests
EUR 689

Pigw ELISA Kit| Rat Phosphatidylinositol-glycan biosynthesis cl

EF019162 96 Tests
EUR 689

Gpld1 ELISA Kit| Mouse Phosphatidylinositol-glycan-specific pho

EF015080 96 Tests
EUR 689

GPLD1 ELISA Kit| Bovine Phosphatidylinositol-glycan-specific ph

EF011449 96 Tests
EUR 689

Pigl/ Rat Pigl ELISA Kit

ELI-36404r 96 Tests
EUR 886

Human Phosphatidylinositol- glycan- specific phospholipase D, GP

ELI-37994h 96 Tests
EUR 824

Recombinant human Phosphatidylinositol-glycan-specific phospholipase D

P1476 100ug Ask for price
  • Uniprot ID: P80108
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan-specific phospholipase D

Human PIGF/ Phosphatidylinositol-glycan biosynthesis class F protein ELISA Kit

E1935Hu 1 Kit
EUR 520

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) ELISA Kit

abx382224-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) ELISA Kit

abx382225-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) ELISA Kit

abx382229-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) ELISA Kit

abx382230-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) ELISA Kit

abx382233-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit

abx385272-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) ELISA Kit

abx253462-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) ELISA kit

CSB-EL017970HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-48T 48T
EUR 332
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-96T 96T
EUR 539
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody

abx030107-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody

abx030107-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx236442-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody

abx236445-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Cow Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516609-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516611-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516612-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Bovine GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E0302Bo 1 Kit
EUR 717

ELISA kit for Bovine Phosphatidylinositol-glycan-specific phospholipase D

EK3273 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Gpld1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E1647Mo 1 Kit
EUR 632

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)

KTE61211-48T 48T
EUR 332
  • Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)

KTE61211-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)

KTE61211-96T 96T
EUR 539
  • Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco
  • Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


ELI-12683h 96 Tests
EUR 824

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE61212-48T 48T
EUR 332
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE61212-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE61212-96T 96T
EUR 539
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Phosphatidylinositol-glycan biosynthesis class X protein (PIGX)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphatidylinositol-glycan biosynthesis class X protein(PIGX),partial expressed in E.coli

Recombinant human Phosphatidylinositol-glycan biosynthesis class W protein

P2643 100ug Ask for price
  • Uniprot ID: Q7Z7B1
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan biosynthesis class W protein

Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) ELISA Kit

abx513179-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Pigf/ Phosphatidylinositol-glycan biosynthesis class F protein ELISA Kit

E1135Mo 1 Kit
EUR 546

Mouse Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit

abx390209-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit

abx391802-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Phosphatidylinositol- glycan- specific phospholipase D, G

ELI-35703b 96 Tests
EUR 928

Mouse Phosphatidylinositol- glycan- specific phospholipase D, Gp

ELI-36278m 96 Tests
EUR 865

Rat Phosphatidylinositol- glycan- specific phospholipase D, Gpld

ELI-43647r 96 Tests
EUR 886

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PIGL ELISA Kit (Human) (OKCD04223)

OKCD04223 96 Wells
EUR 831
Description: Description of target: This gene encodes an enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which is the de-N-acetylation of N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI). Study of a similar rat enzyme suggests that this protein localizes to the endoplasmic reticulum.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE101103-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE101103-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE101103-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE70756-48T 48T
EUR 332
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE70756-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE70756-96T 96T
EUR 539
  • PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE90167-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE90167-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)

KTE90167-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Pigl ELISA KIT

ELI-22728m 96 Tests
EUR 865


ELI-38037b 96 Tests
EUR 928

Phosphatidylinositol Glycan Anchor Biosynthesis Class Y (PIGY) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (Pigo) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class W Protein (PIGW) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx026766-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx026766-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody

abx027141-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody

abx027141-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

abx027158-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

abx027158-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx029081-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx029081-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody

abx029405-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody

abx029405-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Y (PIGY) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class W Protein (PIGW) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

abx331333-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody

abx236438-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx236439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody

abx236440-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody

abx236443-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx236444-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody

abx236447-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class F Protein (PIGF) Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGL antibody

70R-4483 50 ug
EUR 467
Description: Rabbit polyclonal PIGL antibody raised against the N terminal of PIGL

PIGL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


YF-PA25350 50 ul
EUR 334
Description: Mouse polyclonal to PIGL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human PIGL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGL Recombinant Protein (Human)

RP023458 100 ug Ask for price

PIGL Polyclonal Antibody

A68218 100 µg
EUR 570.55
Description: The best epigenetics products

PIGL Blocking Peptide

33R-5892 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGL antibody, catalog no. 70R-4483

PIGL cloning plasmid

CSB-CL897465HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 759
  • Sequence: atggaagcaatgtggctcctgtgtgtggcgttggcggtcttggcatggggcttcctctgggtttgggactcctcagaacgaatgaagagtcgggagcagggaggacggctgggagccgaaagccggaccctgctggtcatagcgcaccctgacgatgaagccatgttttttgctcc
  • Show more
Description: A cloning plasmid for the PIGL gene.

Anti-PIGL (2B6)

YF-MA16880 100 ug
EUR 363
Description: Mouse monoclonal to PIGL

Phosphatidylinositol (PI) ELISA Kit

  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

PIGL ORF Vector (Human) (pORF)

ORF007820 1.0 ug DNA
EUR 95

Human Phosphatidylinositol antibody IgG ELISA kit

E01P0003-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgG ELISA kit

E01P0003-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgG ELISA kit

E01P0003-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit

E01P0009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit

E01P0009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit

E01P0009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit

E01P0185-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit

E01P0185-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit

E01P0185-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit

E01P0655-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit

E01P0655-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit

E01P0655-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human phosphatidylinositol antibody (IgM) ELISA Kit

CSB-E15750h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgM) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phosphatidylinositol antibody (IgM) ELISA Kit

  • EUR 814.00
  • EUR 5171.00
  • EUR 2742.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgM) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human phosphatidylinositol antibody (IgG) ELISA Kit

CSB-E04949h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phosphatidylinositol antibody (IgG) ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat PIGL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PIGL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGL Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGL Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGL Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGL Recombinant Protein (Rat)

RP220478 100 ug Ask for price

PIGL Recombinant Protein (Mouse)

RP162041 100 ug Ask for price

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit

GA-E1963HM-48T 48T
EUR 289

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit

GA-E1963HM-96T 96T
EUR 466

Human Cathepsin L,Cath-L ELISA Kit

201-12-0500 96 tests
EUR 440
  • This Cathepsin L ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human L-Dihydroxyphenyalanine,L-DOPA ELISA Kit

201-12-1947 96 tests
EUR 440
  • This L-Dihydroxyphenyalanine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit

QY-E00004 96T
EUR 361

General Phosphatidylinositol (PI) ELISA Kit

CEG853Ge-10x96wellstestplate 10x96-wells test plate
EUR 5451.45
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit

CEG853Ge-1x48wellstestplate 1x48-wells test plate
EUR 536.59
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit

CEG853Ge-1x96wellstestplate 1x96-wells test plate
EUR 723.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit

CEG853Ge-5x96wellstestplate 5x96-wells test plate
EUR 2956.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit

  • EUR 5502.00
  • EUR 2907.00
  • EUR 724.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phosphatidylinositol elisa. Alternative names of the recognized antigen: PtdIns
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Phosphatidylinositol (PI) in samples from biological agents with no significant corss-reactivity with analogues from other species.

Phosphatidylinositol Trisphosphate (PIP3) ELISA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Phosphatidylinositol 4-phosphate ELISA Kit

EUR 1209
Description: The Phosphatidylinositol 4-phosphate ELISA Kit is designed to detect and quantify PI(4)P by means of a competitive ELISA format, eliminating the need for radioactivity and thin layer chromatography. The PI(4)P Mass ELISA directly detects PI(4)P over all o

General Phosphatidylinositol ELISA Kit (PI)

RK00707 96 Tests
EUR 573

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PIGL sgRNA CRISPR Lentivector set (Human)

K1647601 3 x 1.0 ug
EUR 339

Human Phosphatidylinositol 3 kinases 2a ELISA kit

E01P0093-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinases 2a ELISA kit

E01P0093-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinases 2a ELISA kit

E01P0093-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PTPRQ/ Phosphatidylinositol phosphatase PTPRQ ELISA Kit

E2094Hu 1 Kit
EUR 605

Phosphatidylinositol Antibody (IgG) (Human) ELISA Kit (OKCA00511)

OKCA00511 96 Wells
EUR 859
Description: Description of target: Phosphatidylinositol Antibody (IgG);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

Phosphatidylinositol Antibody (IgM) (Human) ELISA Kit (OKCA00512)

OKCA00512 96 Wells
EUR 872
Description: Description of target: Phosphatidylinositol Antibody (IgM);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit

E01D0041-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit

E01D0041-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit

E01D0041-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit

GA-E0855HM-48T 48T
EUR 289

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit

GA-E0855HM-96T 96T
EUR 466

Human L-Lactate Dehydrogenase (L-LDH) ELISA Kit

abx053270-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human L-Lactate Dehydrogenase,L-LDH ELISA Kit

201-12-0839 96 tests
EUR 440
  • This L-Lactate Dehydrogenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurofilament protein L (NF-L) ELISA kit

CSB-E16094h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein L (NF-L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurofilament protein L (NF-L) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein L (NF-L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit

QY-E04814 96T
EUR 361

Human L selectin ELISA kit

E01L0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L selectin ELISA kit

E01L0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L selectin ELISA kit

E01L0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L phenylalanine ELISA kit

E01L0256-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human L phenylalanine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit