Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit

Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit

Human Phosphatidylinositol Glycan L (PIGL) ELISA Kit
SEH399Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatidylinositol Glycan L (PIGL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatidylinositol Glycan L (PIGL) in tissue homogenates, cell lysates and other biological fluids.

Human Phosphatidylinositol Glycan L (PIGL) ELISA Kit
4-SEH399Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phosphatidylinositol Glycan L elisa. Alternative names of the recognized antigen: N-Acetylglucosaminylphosphatidylinositol Deacetylase Phosphatidylinositol Glycan Anchor Biosynthesis, Class L N-acetylglucosaminyl-phosphatidylinositol Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatidylinositol Glycan L (PIGL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Phosphatidylinositol Glycan L (PIGL) Antibody
abx029109-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody
abx029109-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody
20-abx301765	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Phosphatidylinositol Glycan L (PIGL) CLIA Kit
20-abx495447	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PIGL (Phosphatidylinositol Glycan L)
ELK5471	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phosphatidylinositol Glycan L (PIGL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phosphatidylinositol Glycan L from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Phosphatidylinositol Glycan L (PIGL) Antibody (HRP)
20-abx312501	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody (FITC)
20-abx312502	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan L (PIGL) Antibody (Biotin)
20-abx312503	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Phosphatidylinositol Glycan, Class M (PIGM) ELISA Kit
abx382228-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan, Class S (PIGS) ELISA Kit
abx382231-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pigw ELISA Kit| Mouse Phosphatidylinositol-glycan biosynthesis
EF015848	Lifescience Market	96 Tests	EUR 689

PIGW ELISA Kit| Bovine Phosphatidylinositol-glycan biosynthesis
EF011744	Lifescience Market	96 Tests	EUR 689

Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx573546-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D
EK3272	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E1050Hu	Sunlong	1 Kit	EUR 605

Human GPLD1(Phosphatidylinositol-glycan-specific phospholipase D) ELISA Kit
EH1534	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: P80108 Alias: GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1)/GPIPLD/GPIPLDM/PIGPLD/PIGPLD1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit
CSB-EL009721HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit
1-CSB-EL009721HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Gpld1 ELISA Kit| Rat Phosphatidylinositol-glycan-specific phosp
EF018760	Lifescience Market	96 Tests	EUR 689

Pigw ELISA Kit| Rat Phosphatidylinositol-glycan biosynthesis cl
EF019162	Lifescience Market	96 Tests	EUR 689

Gpld1 ELISA Kit| Mouse Phosphatidylinositol-glycan-specific pho
EF015080	Lifescience Market	96 Tests	EUR 689

GPLD1 ELISA Kit| Bovine Phosphatidylinositol-glycan-specific ph
EF011449	Lifescience Market	96 Tests	EUR 689

Pigl/ Rat Pigl ELISA Kit
ELI-36404r	Lifescience Market	96 Tests	EUR 886

Human Phosphatidylinositol- glycan- specific phospholipase D, GP
ELI-37994h	Lifescience Market	96 Tests	EUR 824

Recombinant human Phosphatidylinositol-glycan-specific phospholipase D
P1476	FN Test	100ug	Ask for price
Uniprot ID: P80108 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan-specific phospholipase D

Human PIGF/ Phosphatidylinositol-glycan biosynthesis class F protein ELISA Kit
E1935Hu	Sunlong	1 Kit	EUR 520

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) ELISA Kit
abx382224-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) ELISA Kit
abx382225-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) ELISA Kit
abx382229-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) ELISA Kit
abx382230-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) ELISA Kit
abx382233-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit
abx385272-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) ELISA Kit
abx253462-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) ELISA kit
CSB-EL017970HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) ELISA kit
1-CSB-EL017970HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein(PIGF) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-48T	Abbkine	48T	EUR 332
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-96T	Abbkine	96T	EUR 539
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody
20-abx114443	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody
abx030107-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody
abx030107-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody
abx032299-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody
abx032299-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody
20-abx309861	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody
abx236442-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody
abx236445-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Cow Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516609-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516611-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516612-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Bovine GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E0302Bo	Sunlong	1 Kit	EUR 717

ELISA kit for Bovine Phosphatidylinositol-glycan-specific phospholipase D
EK3273	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Gpld1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E1647Mo	Sunlong	1 Kit	EUR 632

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)
KTE61211-48T	Abbkine	48T	EUR 332
Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)
KTE61211-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL)
KTE61211-96T	Abbkine	96T	EUR 539
Glycosylphosphatidylinositol (GPI) is used as a membrane anchor by many eukaryotic cell surface proteins. The first step in GPI biosynthesis involves the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI) . The seco Show more
Description: Quantitative sandwich ELISA for measuring Human N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (PIGL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human PIGL ELISA KIT
ELI-12683h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE61212-48T	Abbkine	48T	EUR 332
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE61212-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE61212-96T	Abbkine	96T	EUR 539
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Phosphatidylinositol-glycan biosynthesis class X protein (PIGX)
1-CSB-EP848395HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphatidylinositol-glycan biosynthesis class X protein(PIGX),partial expressed in E.coli

Recombinant human Phosphatidylinositol-glycan biosynthesis class W protein
P2643	FN Test	100ug	Ask for price
Uniprot ID: Q7Z7B1 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan biosynthesis class W protein

Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) ELISA Kit
abx513179-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Pigf/ Phosphatidylinositol-glycan biosynthesis class F protein ELISA Kit
E1135Mo	Sunlong	1 Kit	EUR 546

Mouse Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit
abx390209-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) ELISA Kit
abx391802-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Phosphatidylinositol- glycan- specific phospholipase D, G
ELI-35703b	Lifescience Market	96 Tests	EUR 928

Mouse Phosphatidylinositol- glycan- specific phospholipase D, Gp
ELI-36278m	Lifescience Market	96 Tests	EUR 865

Rat Phosphatidylinositol- glycan- specific phospholipase D, Gpld
ELI-43647r	Lifescience Market	96 Tests	EUR 886

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (HRP)
20-abx309862	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (FITC)
20-abx309863	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class S (PIGS) Antibody (Biotin)
20-abx309864	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PIGL ELISA Kit (Human) (OKCD04223)
OKCD04223	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This gene encodes an enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which is the de-N-acetylation of N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI). Study of a similar rat enzyme suggests that this protein localizes to the endoplasmic reticulum.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE101103-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE101103-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE101103-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE70756-48T	Abbkine	48T	EUR 332
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE70756-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE70756-96T	Abbkine	96T	EUR 539
PIGF encodes 1 of the enzymes involved in glycosylphosphatidylinositol (GPI) anchor biosynthesis. The primary biochemical defect in paroxysmal nocturnal hemoglobinuria (PNH), an acquired hematologic disorder with protean clinical manifestations inclu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE90167-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE90167-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF)
KTE90167-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rabbit Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Pigl ELISA KIT
ELI-22728m	Lifescience Market	96 Tests	EUR 865

Bovine PIGL ELISA KIT
ELI-38037b	Lifescience Market	96 Tests	EUR 928

Phosphatidylinositol Glycan Anchor Biosynthesis Class Y (PIGY) Antibody
20-abx119447	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody
20-abx114440	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody
20-abx114441	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (Pigo) Antibody
20-abx114444	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody
20-abx114446	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody
20-abx121553	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx006618	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class W Protein (PIGW) Antibody
20-abx007920	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody
20-abx008121	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody
20-abx003870	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody
abx031401-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody
abx031401-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx026766-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx026766-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody
abx027141-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody
abx027141-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
abx027158-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
abx027158-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
20-abx014711	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody
abx029405-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody
abx029405-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody
20-abx308331	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody
20-abx324617	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Y (PIGY) Antibody
20-abx325218	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class F protein (PIGF) Antibody
20-abx325235	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
20-abx325236	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx217763	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody
20-abx217765	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx217767	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class W Protein (PIGW) Antibody
20-abx217769	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody
20-abx338711	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody
20-abx338514	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
abx331333-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
20-abx333889	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody
20-abx318563	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody
20-abx318644	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody
abx236438-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody
abx236439-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class F (PIGF) Antibody
abx236440-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody
abx236443-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx236444-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody
abx236447-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody
20-abx302041	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx302113	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-Glycan Biosynthesis Class F Protein (PIGF) Blocking Peptide
20-abx162646	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (HRP)
20-abx306874	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (FITC)
20-abx306875	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class H (PIGH) Antibody (Biotin)
20-abx306876	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (HRP)
20-abx308332	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (FITC)
20-abx308333	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class Z (PIGZ) Antibody (Biotin)
20-abx308334	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP)
20-abx314272	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC)
20-abx314273	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin)
20-abx314274	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (HRP)
20-abx309955	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (FITC)
20-abx309956	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class X (PIGX) Antibody (Biotin)
20-abx309957	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (HRP)
20-abx310345	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (FITC)
20-abx310346	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class O (PIGO) Antibody (Biotin)
20-abx310347	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP)
20-abx337009	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC)
20-abx337010	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin)
20-abx337011	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (HRP)
20-abx337015	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (FITC)
20-abx337016	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol-glycan biosynthesis class W protein (PIGW) Antibody (Biotin)
20-abx337017	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (HRP)
20-abx335841	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (FITC)
20-abx335842	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class V (PIGV) Antibody (Biotin)
20-abx335843	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PIGL siRNA
20-abx904012	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGL siRNA
20-abx928570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGL siRNA
20-abx928571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGL antibody
70R-4483	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PIGL antibody raised against the N terminal of PIGL

PIGL Antibody
1-CSB-PA897465LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-PIGL
YF-PA25350	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PIGL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human PIGL shRNA Plasmid
20-abx956299	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PIGL Recombinant Protein (Human)
RP023458	ABM	100 ug	Ask for price

PIGL Polyclonal Antibody
A68218	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PIGL Blocking Peptide
33R-5892	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGL antibody, catalog no. 70R-4483

PIGL cloning plasmid
CSB-CL897465HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 759 Sequence: atggaagcaatgtggctcctgtgtgtggcgttggcggtcttggcatggggcttcctctgggtttgggactcctcagaacgaatgaagagtcgggagcagggaggacggctgggagccgaaagccggaccctgctggtcatagcgcaccctgacgatgaagccatgttttttgctcc Show more
Description: A cloning plasmid for the PIGL gene.

Anti-PIGL (2B6)
YF-MA16880	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PIGL

Phosphatidylinositol (PI) ELISA Kit
20-abx258963	Abbexa	EUR 7645.00 EUR 4074.00 EUR 942.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

PIGL ORF Vector (Human) (pORF)
ORF007820	ABM	1.0 ug DNA	EUR 95

Human Phosphatidylinositol antibody IgG ELISA kit
E01P0003-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgG ELISA kit
E01P0003-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgG ELISA kit
E01P0003-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgG in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit
E01P0009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit
E01P0009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol Bisphosphate (PIP2) ELISA kit
E01P0009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol Bisphosphate (PIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinase ELISA kit
E01P0185-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit
E01P0655-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit
E01P0655-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol antibody IgM ELISA kit
E01P0655-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol antibody IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human phosphatidylinositol antibody (IgM) ELISA Kit
CSB-E15750h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgM) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phosphatidylinositol antibody (IgM) ELISA Kit
1-CSB-E15750h	Cusabio	EUR 814.00 EUR 5171.00 EUR 2742.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgM) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human phosphatidylinositol antibody (IgG) ELISA Kit
CSB-E04949h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human phosphatidylinositol antibody (IgG) ELISA Kit
1-CSB-E04949h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitativeindirect ELISA kit for measuring Human phosphatidylinositol antibody (IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat PIGL shRNA Plasmid
20-abx987868	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PIGL shRNA Plasmid
20-abx983498	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PIGL Antibody, HRP conjugated
1-CSB-PA897465LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGL Antibody, FITC conjugated
1-CSB-PA897465LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGL Antibody, Biotin conjugated
1-CSB-PA897465LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGL. Recognizes PIGL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGL Recombinant Protein (Rat)
RP220478	ABM	100 ug	Ask for price

PIGL Recombinant Protein (Mouse)
RP162041	ABM	100 ug	Ask for price

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit
GA-E1963HM-48T	GenAsia Biotech	48T	EUR 289

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit
GA-E1963HM-96T	GenAsia Biotech	96T	EUR 466

Human Cathepsin L,Cath-L ELISA Kit
201-12-0500	SunredBio	96 tests	EUR 440
This Cathepsin L ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human L-Dihydroxyphenyalanine,L-DOPA ELISA Kit
201-12-1947	SunredBio	96 tests	EUR 440
This L-Dihydroxyphenyalanine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human L-Dihydroxyphenyalanine(L-DOPA)ELISA Kit
QY-E00004	Qayee Biotechnology	96T	EUR 361

General Phosphatidylinositol (PI) ELISA Kit
CEG853Ge-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5451.45
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit
CEG853Ge-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 536.59
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit
CEG853Ge-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 723.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit
CEG853Ge-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2956.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Phosphatidylinositol (PI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Phosphatidylinositol (PI) in biological agents.

General Phosphatidylinositol (PI) ELISA Kit
4-CEG853Ge	Cloud-Clone	EUR 5502.00 EUR 2907.00 EUR 724.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phosphatidylinositol elisa. Alternative names of the recognized antigen: PtdIns
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Phosphatidylinositol (PI) in samples from biological agents with no significant corss-reactivity with analogues from other species.

Phosphatidylinositol Trisphosphate (PIP3) ELISA Kit
20-abx258964	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Phosphatidylinositol 4-phosphate ELISA Kit
DEIA-XYZ11	Creative Diagnostics	96T	EUR 1209
Description: The Phosphatidylinositol 4-phosphate ELISA Kit is designed to detect and quantify PI(4)P by means of a competitive ELISA format, eliminating the need for radioactivity and thin layer chromatography. The PI(4)P Mass ELISA directly detects PI(4)P over all o

General Phosphatidylinositol ELISA Kit (PI)
RK00707	Abclonal	96 Tests	EUR 573

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PIGL sgRNA CRISPR Lentivector set (Human)
K1647601	ABM	3 x 1.0 ug	EUR 339

Human Phosphatidylinositol 3 kinases 2a ELISA kit
E01P0093-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinases 2a ELISA kit
E01P0093-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphatidylinositol 3 kinases 2a ELISA kit
E01P0093-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphatidylinositol 3 kinases 2a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PTPRQ/ Phosphatidylinositol phosphatase PTPRQ ELISA Kit
E2094Hu	Sunlong	1 Kit	EUR 605

Phosphatidylinositol Antibody (IgG) (Human) ELISA Kit (OKCA00511)
OKCA00511	Aviva Systems Biology	96 Wells	EUR 859
Description: Description of target: Phosphatidylinositol Antibody (IgG);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

Phosphatidylinositol Antibody (IgM) (Human) ELISA Kit (OKCA00512)
OKCA00512	Aviva Systems Biology	96 Wells	EUR 872
Description: Description of target: Phosphatidylinositol Antibody (IgM);Species reactivity: Human;Application: ;Assay info: Assay Methodology: Qualitative Reverse Capture ELISA;Sensitivity:

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit
E01D0041-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit
E01D0041-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-DOPA (L-3,4-dihydroxyphenylalanine) ELISA kit
E01D0041-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L-DOPA (L-3,4-dihydroxyphenylalanine) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit
GA-E0855HM-48T	GenAsia Biotech	48T	EUR 289

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit
GA-E0855HM-96T	GenAsia Biotech	96T	EUR 466

Human L-Lactate Dehydrogenase (L-LDH) ELISA Kit
abx053270-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human L-Lactate Dehydrogenase,L-LDH ELISA Kit
201-12-0839	SunredBio	96 tests	EUR 440
This L-Lactate Dehydrogenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurofilament protein L (NF-L) ELISA kit
CSB-E16094h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein L (NF-L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurofilament protein L (NF-L) ELISA kit
1-CSB-E16094h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein L (NF-L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human L-Lactate Dehydrogenase(L-LDH)ELISA Kit
QY-E04814	Qayee Biotechnology	96T	EUR 361

Human L selectin ELISA kit
E01L0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L selectin ELISA kit
E01L0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L selectin ELISA kit
E01L0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L selectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L phenylalanine ELISA kit
E01L0256-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human L phenylalanine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PIGL(Phosphatidylinositol Glycan L) ELISA Kit