Human CLDN8(Claudin 8) ELISA Kit

Human Claudin- 8, CLDN8 ELISA KIT

ELI-31910h 96 Tests
EUR 824

Human Claudin 8(CLDN8)ELISA Kit

QY-E03548 96T
EUR 361

Human Claudin 8 (CLDN8) ELISA Kit

SEF298Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids.

Human Claudin 8 (CLDN8) ELISA Kit

SEF298Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids.

Human Claudin 8 (CLDN8) ELISA Kit

SEF298Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids.

Human Claudin 8 (CLDN8) ELISA Kit

SEF298Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids.

Human Claudin 8 (CLDN8) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Claudin 8 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Claudin 8 (CLDN8) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Claudin 8 (CLDN8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

abx149370-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

abx034285-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

abx034285-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

abx330891-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Claudin 8 (CLDN8) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Goat Claudin 8(CLDN8) ELISA kit

E06C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 8(CLDN8) ELISA kit

E06C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 8(CLDN8) ELISA kit

E06C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 8(CLDN8) ELISA kit

E03C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 8(CLDN8) ELISA kit

E03C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 8(CLDN8) ELISA kit

E03C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 8(CLDN8) ELISA kit

E04C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 8(CLDN8) ELISA kit

E04C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 8(CLDN8) ELISA kit

E04C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 8(CLDN8) ELISA kit

E02C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 8(CLDN8) ELISA kit

E02C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 8(CLDN8) ELISA kit

E02C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 8(CLDN8) ELISA kit

E07C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 8(CLDN8) ELISA kit

E07C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 8(CLDN8) ELISA kit

E07C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 8(CLDN8) ELISA kit

E09C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 8(CLDN8) ELISA kit

E09C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 8(CLDN8) ELISA kit

E09C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 8(CLDN8) ELISA kit

E08C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 8(CLDN8) ELISA kit

E08C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 8(CLDN8) ELISA kit

E08C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin- 8, Cldn8 ELISA KIT

ELI-50980m 96 Tests
EUR 865

ELISA kit for Human CLDN8 (Claudin 8)

ELK5349 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Claudin 8 (CLDN8). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Claudin 8 (CLDN8
  • Show more
Description: A sandwich ELISA kit for detection of Claudin 8 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Claudin-8 (CLDN8)

KTE62281-48T 48T
EUR 332
  • Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Claudin-8 (CLDN8)

KTE62281-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Claudin-8 (CLDN8)

KTE62281-96T 96T
EUR 539
  • Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Claudin 8 (CLDN8) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Guinea pig Claudin 8(CLDN8) ELISA kit

E05C0991-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 8(CLDN8) ELISA kit

E05C0991-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 8(CLDN8) ELISA kit

E05C0991-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Claudin 8 (CLDN8) Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

1730 8 SNAP-SEAL 8 OZ

1730-8 100/pk
EUR 74
Description: Disposable Plastic; Plastic Containers

Human IL-8 Recombinant Protein

R00423-8 5ug/vial
EUR 259
Description: Interleukin-8 (IL-8), also known as CXCL8, is an ELR-positive CXC family member chemokine produced by macrophages and other cell types such as epithelial cells. ELR-positive CXC chemokines such as IL-8 specifically induce the migration of neutrophils, and interact with chemokine receptors CXCR1 and CXCR2. Human IL-8 Recombinant Protein is purified interleukin-8 produced in yeast.

8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

DLR-8-OHdG-Ge-48T 48T
EUR 469
  • Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids.

8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

DLR-8-OHdG-Ge-96T 96T
EUR 608
  • Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids.

Claudin 8 antibody

70R-1695 100 ug
EUR 377
Description: Rabbit polyclonal Claudin 8 antibody raised against the C terminal of CLDN8

anti-Claudin 8

YF-PA16071 50 ug
EUR 363
Description: Mouse polyclonal to Claudin 8

CLDN8 ELISA Kit (Human) (OKCD01865)

OKCD01865 96 Wells
EUR 831
Description: Description of target: Plays a major role in tight junction-specific obliteration of the intercellular space.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RD-8-OHdG-Ge-48Tests 48 Tests
EUR 467

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RD-8-OHdG-Ge-96Tests 96 Tests
EUR 646

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RDR-8-OHdG-Ge-48Tests 48 Tests
EUR 488

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RDR-8-OHdG-Ge-96Tests 96 Tests
EUR 676

Individual Reaction Mix 8

G065-8 200 reactions
EUR 167

Claudin 8 Blocking Peptide

33R-4198 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLDN8 antibody, catalog no. 70R-1695

Claudin-8 Polyclonal Antibody

ABP56950-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130

Claudin-8 Polyclonal Antibody

ABP56950-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130

Claudin-8 Polyclonal Antibody

ABP56950-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130

Claudin-8 Polyclonal Antibody

ES7949-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Claudin-8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Claudin-8 Polyclonal Antibody

ES7949-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Claudin-8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Claudin-8 antibody

STJ92323 200 µl
EUR 197
Description: Rabbit polyclonal to Claudin-8.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

CLDN8 Antibody

34598-100ul 100ul
EUR 252

CLDN8 Antibody

34598-50ul 50ul
EUR 187

CLDN8 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CLDN8 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CLDN8 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CLDN8 Antibody

CSB-PA104901-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CLDN8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CLDN8 Antibody

DF3947 200ul
EUR 304
Description: CLDN8 Antibody detects endogenous levels of total CLDN8.

CLDN8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CLDN8 antibody

70R-36466 100 ug
EUR 327
Description: Rabbit polyclonal CLDN8 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLDN8 Antibody

ABD3947 100 ug
EUR 438

General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit

RD-8-epi-PGF2a-Ge-48Tests 48 Tests
EUR 467

General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit

RD-8-epi-PGF2a-Ge-96Tests 96 Tests
EUR 646

PSA (Prostate-specific antigen) ELISA test

8 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

Human CLDN8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLDN8 Recombinant Protein (Human)

RP007264 100 ug Ask for price

Human Claudin 1 ELISA kit

E01C0381-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit

E01C0381-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit

E01C0381-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Claudin 18 ELISA KIT|Human

EF008702 96 Tests
EUR 689

Claudin 22 ELISA KIT|Human

EF008703 96 Tests
EUR 689

Claudin 23 ELISA KIT|Human

EF008704 96 Tests
EUR 689

Claudin 7 ELISA KIT|Human

EF008706 96 Tests
EUR 689


AP-8-10 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-8-200 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-8-300 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-8-50 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CLDN8 Rabbit pAb

A14470-100ul 100 ul
EUR 308

CLDN8 Rabbit pAb

A14470-200ul 200 ul
EUR 459

CLDN8 Rabbit pAb

A14470-20ul 20 ul
EUR 183

CLDN8 Rabbit pAb

A14470-50ul 50 ul
EUR 223

CLDN8 Blocking Peptide

DF3947-BP 1mg
EUR 195

CLDN8 Conjugated Antibody

C34598 100ul
EUR 397

CLDN8 cloning plasmid

CSB-CL005510HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atggcaacccatgccttagaaatcgctgggctgtttcttggtggtgttggaatggtgggcacagtggctgtcactgtcatgcctcagtggagagtgtcggccttcattgaaaacaacatcgtggtttttgaaaacttctgggaaggactgtggatgaattgcgtgaggcaggctaa
  • Show more
Description: A cloning plasmid for the CLDN8 gene.

CLDN8 Rabbit pAb

A8174-100ul 100 ul
EUR 308

CLDN8 Rabbit pAb

A8174-200ul 200 ul
EUR 459

CLDN8 Rabbit pAb

A8174-20ul 20 ul
EUR 183

CLDN8 Rabbit pAb

A8174-50ul 50 ul
EUR 223

Anti-CLDN8 antibody

STJ110473 100 µl
EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma.

Anti-CLDN8 antibody

STJ116680 100 µl
EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma.

pAAV-DJ/8 Vector

VPK-420-DJ-8 10 µg
EUR 647
Description: The pAAV-DJ/8 vector contains the rep and cap genes required to generated recombinant AAV of serotype DJ/8. Co-transfect with other packaging plasmids and an expression vector into 293 cells for AAV-DJ/8 packaging.

CLDN8 ORF Vector (Human) (pORF)

ORF002422 1.0 ug DNA
EUR 95

human claudin 14,CLDN14 ELISA Kit

201-12-1879 96 tests
EUR 440
  • This claudin 14 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 1 (CLDN1)ELISA kit

201-12-2301 96 tests
EUR 440
  • This Claudin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 2 (CLDN2)ELISA kit

201-12-2302 96 tests
EUR 440
  • This Claudin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human CLDN8(Claudin 8) ELISA Kit