Human CLDN8(Claudin 8) ELISA Kit
Human Claudin 8 (CLDN8) ELISA Kit |
SEF298Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids. |
Human Claudin 8 (CLDN8) ELISA Kit |
SEF298Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids. |
Human Claudin 8 (CLDN8) ELISA Kit |
SEF298Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids. |
Human Claudin 8 (CLDN8) ELISA Kit |
SEF298Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 8 (CLDN8) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 8 (CLDN8) in Tissue homogenates, cell lysates and other biological fluids. |
Human Claudin 8 (CLDN8) ELISA Kit |
4-SEF298Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Claudin 8 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Claudin 8 (CLDN8) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Goat Claudin 8(CLDN8) ELISA kit |
E06C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Claudin 8(CLDN8) ELISA kit |
E06C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Claudin 8(CLDN8) ELISA kit |
E06C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Claudin 8(CLDN8) ELISA kit |
E03C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Claudin 8(CLDN8) ELISA kit |
E03C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Claudin 8(CLDN8) ELISA kit |
E03C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Claudin 8(CLDN8) ELISA kit |
E04C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Claudin 8(CLDN8) ELISA kit |
E04C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Claudin 8(CLDN8) ELISA kit |
E04C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Claudin 8(CLDN8) ELISA kit |
E02C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Claudin 8(CLDN8) ELISA kit |
E02C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Claudin 8(CLDN8) ELISA kit |
E02C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Claudin 8(CLDN8) ELISA kit |
E07C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Claudin 8(CLDN8) ELISA kit |
E07C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Claudin 8(CLDN8) ELISA kit |
E07C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Claudin 8(CLDN8) ELISA kit |
E09C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Claudin 8(CLDN8) ELISA kit |
E09C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Claudin 8(CLDN8) ELISA kit |
E09C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Claudin 8(CLDN8) ELISA kit |
E08C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Claudin 8(CLDN8) ELISA kit |
E08C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Claudin 8(CLDN8) ELISA kit |
E08C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Claudin 8 (CLDN8) Antibody |
20-abx005720 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
20-abx210931 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
20-abx210255 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
20-abx121876 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
abx149370-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
abx034285-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
abx034285-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
20-abx320502 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
abx330891-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Claudin 8 (CLDN8) Antibody |
20-abx324042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human CLDN8 (Claudin 8) |
ELK5349 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Claudin 8 (CLDN8). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Claudin 8 (CLDN8
- Show more
|
Description: A sandwich ELISA kit for detection of Claudin 8 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Claudin-8 (CLDN8) |
KTE62281-48T |
Abbkine |
48T |
EUR 332 |
- Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Claudin-8 (CLDN8) |
KTE62281-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Claudin-8 (CLDN8) |
KTE62281-96T |
Abbkine |
96T |
EUR 539 |
- Claudins, such as CLDN8, are components of epithelial cell tight junctions. Tight junctions regulate movement of solutes and ions through the paracellular space and prevent mixing of proteins and lipids in the outer leaflet of the apical and basolate
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Claudin-8 (CLDN8) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Claudin 8 (CLDN8) CLIA Kit |
20-abx494851 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Guinea pig Claudin 8(CLDN8) ELISA kit |
E05C0991-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Claudin 8(CLDN8) ELISA kit |
E05C0991-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Claudin 8(CLDN8) ELISA kit |
E05C0991-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 8(CLDN8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Claudin 8 (CLDN8) Blocking Peptide |
20-abx161586 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
1730 8 SNAP-SEAL 8 OZ |
1730-8 |
CORNING |
100/pk |
EUR 74 |
Description: Disposable Plastic; Plastic Containers |
Human IL-8 Recombinant Protein |
R00423-8 |
BosterBio |
5ug/vial |
EUR 259 |
Description: Interleukin-8 (IL-8), also known as CXCL8, is an ELR-positive CXC family member chemokine produced by macrophages and other cell types such as epithelial cells. ELR-positive CXC chemokines such as IL-8 specifically induce the migration of neutrophils, and interact with chemokine receptors CXCR1 and CXCR2. Human IL-8 Recombinant Protein is purified interleukin-8 produced in yeast. |
8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
DLR-8-OHdG-Ge-48T |
DL Develop |
48T |
EUR 469 |
- Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids. |
8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
DLR-8-OHdG-Ge-96T |
DL Develop |
96T |
EUR 608 |
- Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids. |
Claudin 8 antibody |
70R-1695 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal Claudin 8 antibody raised against the C terminal of CLDN8 |
anti-Claudin 8 |
YF-PA16071 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Claudin 8 |
General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
RD-8-OHdG-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 467 |
General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
RD-8-OHdG-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 646 |
General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
RDR-8-OHdG-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 488 |
General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit |
RDR-8-OHdG-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 676 |
Individual Reaction Mix 8 |
G065-8 |
ABM |
200 reactions |
EUR 167 |
Claudin 8 Blocking Peptide |
33R-4198 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLDN8 antibody, catalog no. 70R-1695 |
Claudin-8 Polyclonal Antibody |
ABP56950-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130 |
Claudin-8 Polyclonal Antibody |
ABP56950-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130 |
Claudin-8 Polyclonal Antibody |
ABP56950-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Claudin-8 from Human. This Claudin-8 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Claudin-8 at AA range: 50-130 |
Claudin-8 Polyclonal Antibody |
ES7949-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Claudin-8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Claudin-8 Polyclonal Antibody |
ES7949-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Claudin-8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-Claudin-8 antibody |
STJ92323 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Claudin-8. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
CLDN8 Antibody |
34598-100ul |
SAB |
100ul |
EUR 252 |
CLDN8 Antibody |
34598-50ul |
SAB |
50ul |
EUR 187 |
CLDN8 Antibody |
1-CSB-PA005510ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
CLDN8 Antibody |
1-CSB-PA070219 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000 |
CLDN8 Antibody |
CSB-PA104901- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
CLDN8 Antibody |
CSB-PA104901-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
CLDN8 Antibody |
1-CSB-PA982170 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CLDN8 Antibody |
DF3947 |
Affbiotech |
200ul |
EUR 304 |
Description: CLDN8 Antibody detects endogenous levels of total CLDN8. |
CLDN8 Antibody |
1-CSB-PA042402 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CLDN8. Recognizes CLDN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
CLDN8 antibody |
70R-36466 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CLDN8 antibody |
CLDN8 siRNA |
20-abx911997 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLDN8 siRNA |
20-abx911998 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit |
RD-8-epi-PGF2a-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 467 |
General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit |
RD-8-epi-PGF2a-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 646 |
PSA (Prostate-specific antigen) ELISA test |
8 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen) |
Human CLDN8 shRNA Plasmid |
20-abx955989 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CLDN8 Recombinant Protein (Human) |
RP007264 |
ABM |
100 ug |
Ask for price |
Human Claudin 1 ELISA kit |
E01C0381-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Claudin 1 ELISA kit |
E01C0381-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Claudin 1 ELISA kit |
E01C0381-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Claudin-1 ELISA kit |
E01C0973-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Claudin-1 ELISA kit |
E01C0973-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Claudin-1 ELISA kit |
E01C0973-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
0.5-10UL 8-CHANNEL, DIGITAL PIPETTOR |
AP-8-10 |
CORNING |
1/pk |
EUR 425 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
20-200UL 8-CHANNEL, DIGITAL PIPETTOR |
AP-8-200 |
CORNING |
1/pk |
EUR 425 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
50-300UL 8-CHANNEL, DIGITAL PIPETTOR |
AP-8-300 |
CORNING |
1/pk |
EUR 425 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
5-50UL 8-CHANNEL, DIGITAL PIPETTOR |
AP-8-50 |
CORNING |
1/pk |
EUR 425 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
CLDN8 Rabbit pAb |
A14470-100ul |
Abclonal |
100 ul |
EUR 308 |
CLDN8 Rabbit pAb |
A14470-200ul |
Abclonal |
200 ul |
EUR 459 |
CLDN8 Rabbit pAb |
A14470-20ul |
Abclonal |
20 ul |
EUR 183 |
CLDN8 Rabbit pAb |
A14470-50ul |
Abclonal |
50 ul |
EUR 223 |
CLDN8 Blocking Peptide |
DF3947-BP |
Affbiotech |
1mg |
EUR 195 |
CLDN8 Conjugated Antibody |
C34598 |
SAB |
100ul |
EUR 397 |
CLDN8 cloning plasmid |
CSB-CL005510HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 678
- Sequence: atggcaacccatgccttagaaatcgctgggctgtttcttggtggtgttggaatggtgggcacagtggctgtcactgtcatgcctcagtggagagtgtcggccttcattgaaaacaacatcgtggtttttgaaaacttctgggaaggactgtggatgaattgcgtgaggcaggctaa
- Show more
|
Description: A cloning plasmid for the CLDN8 gene. |
CLDN8 Rabbit pAb |
A8174-100ul |
Abclonal |
100 ul |
EUR 308 |
CLDN8 Rabbit pAb |
A8174-200ul |
Abclonal |
200 ul |
EUR 459 |
CLDN8 Rabbit pAb |
A8174-20ul |
Abclonal |
20 ul |
EUR 183 |
CLDN8 Rabbit pAb |
A8174-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-CLDN8 antibody |
STJ110473 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma. |
Anti-CLDN8 antibody |
STJ116680 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma. |
pAAV-DJ/8 Vector |
VPK-420-DJ-8 |
Cell Biolabs |
10 µg |
EUR 647 |
Description: The pAAV-DJ/8 vector contains the rep and cap genes required to generated recombinant AAV of serotype DJ/8. Co-transfect with other packaging plasmids and an expression vector into 293 cells for AAV-DJ/8 packaging. |
CLDN8 ORF Vector (Human) (pORF) |
ORF002422 |
ABM |
1.0 ug DNA |
EUR 95 |
human claudin 14,CLDN14 ELISA Kit |
201-12-1879 |
SunredBio |
96 tests |
EUR 440 |
- This claudin 14 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Claudin 1 (CLDN1)ELISA kit |
201-12-2301 |
SunredBio |
96 tests |
EUR 440 |
- This Claudin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Claudin 2 (CLDN2)ELISA kit |
201-12-2302 |
SunredBio |
96 tests |
EUR 440 |
- This Claudin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Claudin 3 (CLDN3)ELISA kit |
201-12-2303 |
SunredBio |
96 tests |
EUR 440 |
- This Claudin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human CLDN8(Claudin 8) ELISA Kit