Human HBd(Hemoglobin Delta) ELISA Kit

Human HBd(Hemoglobin Delta) ELISA Kit

Human Hemoglobin Delta (HBd) ELISA Kit
4-CED092Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hemoglobin Delta elisa. Alternative names of the recognized antigen: Delta-globin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin Delta (HBd) in samples from Serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hemoglobin Delta (HBd) ELISA Kit
20-abx258328	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hemoglobin Delta(HBd)ELISA Kit
QY-E00671	Qayee Biotechnology	96T	EUR 361

Hemoglobin Delta (HBD) Antibody
20-abx124331	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody
20-abx112966	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hemoglobin Delta (HBd) Antibody
20-abx129104	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hemoglobin Delta (HBD) Antibody
abx233769-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Hemoglobin Delta (HBD) Antibody
20-abx301205	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Hemoglobin Delta (HBd)
4-RPD092Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P02042 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Hemoglobin Delta expressed in: E.coli

Human Hemoglobin Delta (HBd) Protein
20-abx166874	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hemoglobin Delta (HBd) CLIA Kit
20-abx490488	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human HBd (Hemoglobin Delta)
ELK5336	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Hemoglobin Delta (HBd) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Hemoglobin Delta (HBd) and unlabeled Hemoglobin Delta (HBd) (Standards or samples) wi Show more
Description: A competitive Inhibition ELISA kit for detection of Hemoglobin Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Hemoglobin subunit delta, HBD ELISA KIT
ELI-30857h	Lifescience Market	96 Tests	EUR 824

Human Hemoglobin subunit delta(HBD) ELISA kit
CSB-EL010152HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta (HBD) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hemoglobin subunit delta(HBD) ELISA kit
1-CSB-EL010152HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta(HBD) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Hemoglobin Delta (HBD) Antibody (HRP)
20-abx304122	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody (FITC)
20-abx304123	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody (Biotin)
20-abx304124	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human)
4-PAD092Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd)

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC
4-PAD092Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Biotinylated
4-PAD092Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Biotin.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Cy3
4-PAD092Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Cy3.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), FITC
4-PAD092Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with FITC.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), HRP
4-PAD092Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with HRP.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), PE
4-PAD092Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with PE.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC-Cy7
4-PAD092Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBd (Met1~Ala143) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC-Cy7.

HBD ELISA KIT|Human
EF010068	Lifescience Market	96 Tests	EUR 689

Anti-Human Hemoglobin Antibody [Clone HBD-Q2], Unconjugated-100ug
QDX11-100ug	EnQuireBio	100ug	EUR 251

Anti-Human Hemoglobin Antibody [Clone HBD-Q7], Unconjugated-100ug
QDX12-100ug	EnQuireBio	100ug	EUR 251

Hemoglobin (Human) ELISA Kit
E4738-100	Biovision		EUR 620

Human Hemoglobin ELISA Kit
E-80HM	Immunology Consultants Laboratory	1 x 96 well plate	EUR 441

HBD siRNA
20-abx919125	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HBD antibody
70R-17691	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HBD antibody

HBD Antibody
1-CSB-PA010152GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HBD. Recognizes HBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HBD Antibody
1-CSB-PA010152LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBD. Recognizes HBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human HBD shRNA Plasmid
20-abx952071	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HBD Recombinant Protein (Human)
RP014431	ABM	100 ug	Ask for price

Human Hemoglobin (HB) ELISA Kit
CEB409Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 2754.91
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit
CEB409Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 314.52
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit
CEB409Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 406.46
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit
CEB409Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1529.07
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit
4-CEB409Hu	Cloud-Clone	EUR 2805.00 EUR 1480.00 EUR 407.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hemoglobin elisa. Alternative names of the recognized antigen: Hgb Haemoglobin Heterotetramer(αβ)2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin (HB) in samples from serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hemoglobin, Mu ELISA kit
E01H0041-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin, Mu ELISA kit
E01H0041-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin, Mu ELISA kit
E01H0041-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit
E01H0227-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit
E01H0227-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit
E01H0227-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit
E01H0228-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit
E01H0228-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit
E01H0228-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit
E01H1362-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit
E01H1362-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit
E01H1362-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Hemoglobin epsilon ELISA KIT|Human
EF010099	Lifescience Market	96 Tests	EUR 689

Human Hemoglobin (HB) ELISA Kit
20-abx151788	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hemoglobin (HB) ELISA Kit
abx253149-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Hemoglobin (HB)ELISA kit
201-12-2289	SunredBio	96 tests	EUR 440
This Hemoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Hemoglobin (Hb) ELISA Kit
CSB-E16994h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hemoglobin (Hb) ELISA Kit
1-CSB-E16994h	Cusabio	EUR 500.00 EUR 3402.00 EUR 1820.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Hemoglobin
KTE63008-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hemoglobin
KTE63008-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hemoglobin
KTE63008-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Hemoglobin ELISA Kit (HB)
RK01540	Abclonal	96 Tests	EUR 521

Human Hemoglobin(HB)ELISA Kit
QY-E00680	Qayee Biotechnology	96T	EUR 361

Hemoglobin ELISA Kit (Human) (OKIA00065)
OKIA00065	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.103 ng/ml

HBD cloning plasmid
CSB-CL010152HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 444 Sequence: atggtgcatctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaacgtggatgcagttggtggtgaggccctgggcagattactggtggtctacccttggacccagaggttctttgagtcctttggggatctgtcctctcctgatgctgttatgggcaaccc Show more
Description: A cloning plasmid for the HBD gene.

anti- HBD antibody
FNab03769	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: hemoglobin, delta Uniprot ID: P02042 Gene ID: 3045 Research Area: Cardiovascular
Description: Antibody raised against HBD

Anti-HBD Antibody
A01076	BosterBio	100ug/vial	EUR 334

HBD Polyclonal Antibody
A59338	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

HBD Rabbit pAb
A9220-100ul	Abclonal	100 ul	EUR 308

HBD Rabbit pAb
A9220-200ul	Abclonal	200 ul	EUR 459

HBD Rabbit pAb
A9220-20ul	Abclonal	20 ul	EUR 183

HBD Rabbit pAb
A9220-50ul	Abclonal	50 ul	EUR 223

HBD Polyclonal Antibody
31684-100ul	SAB	100ul	EUR 252

HBD Polyclonal Antibody
31684-50ul	SAB	50ul	EUR 187

Anti-HBD antibody
PAab03769	Lifescience Market	100 ug	EUR 386

Anti-HBD antibody
STJ113626	St John's Laboratory	100 µl	EUR 277
Description: The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia.

Hemoglobin (Mouse) ELISA Kit
E4739-100	Biovision		EUR 620

Rat Hemoglobin ELISA Kit
E-25HM	Immunology Consultants Laboratory	1 x 96 well plate	EUR 441

Dog Hemoglobin ELISA Kit
E-40HM	Immunology Consultants Laboratory	1 x 96 well plate	EUR 461

Mouse Hemoglobin ELISA Kit
E-90HM	Immunology Consultants Laboratory	1 x 96 well plate	EUR 441

Rat HbA1C(Glycosylated Hemoglobin/Hemoglobin A1c) ELISA Kit
ER1030	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ng/ml Alias: HbA1C/Glycosylated Hemoglobin/Hemoglobin A1c
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml

HBD ORF Vector (Human) (pORF)
ORF004811	ABM	1.0 ug DNA	EUR 95

Human Fetal Hemoglobin (HBF) ELISA Kit
CEA996Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids.

Human Fetal Hemoglobin (HBF) ELISA Kit
CEA996Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids.

Human Fetal Hemoglobin (HBF) ELISA Kit
CEA996Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids.

Human Fetal Hemoglobin (HBF) ELISA Kit
CEA996Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids.

Human Fetal Hemoglobin (HBF) ELISA Kit
4-CEA996Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fetal Hemoglobin elisa. Alternative names of the recognized antigen: hemoglobin F Foetal Haemoglobin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Fetal Hemoglobin (HBF) in samples from serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hemoglobin Beta (HBb) ELISA Kit
CED098Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates.

Human Hemoglobin Beta (HBb) ELISA Kit
CED098Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates.

Human Hemoglobin Beta (HBb) ELISA Kit
CED098Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates.

Human Hemoglobin Beta (HBb) ELISA Kit
CED098Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates.

Human Hemoglobin Beta (HBb) ELISA Kit
4-CED098Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hemoglobin Beta elisa. Alternative names of the recognized antigen: HB-B HBD CD113t-C Beta Globin Spinorphin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin Beta (HBb) in samples from serum, plasma and erythrocyte lysates with no significant corss-reactivity with analogues from other species.

Human Hemoglobin Mu (HBM) ELISA Kit
abx575241-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Glycated hemoglobin A1c ELISA kit
E01G0322-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycated hemoglobin A1c ELISA kit
E01G0322-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycated hemoglobin A1c ELISA kit
E01G0322-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit
E01H0226-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit
E01H0226-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit
E01H0226-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Hemoglobin (Hb)
EK0214	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hemoglobin (Hb) in samples from serum, plasma, tissue homogenates and other biological fluids.

Hemoglobin A1c (HbA1c) (Human) ELISA Kit
E4656-100	Biovision		EUR 805

Human HbH(Hemoglobin H) ELISA Kit
EH3214	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ug/ml Alias: HbH
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ug/ml

Human HBd(Hemoglobin Delta) ELISA Kit