Human HBd(Hemoglobin Delta) ELISA Kit

Human HBd(Hemoglobin Delta) ELISA Kit

Human Hemoglobin Delta (HBd) ELISA Kit

CED092Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Delta (HBd) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Delta (HBd) in serum, plasma, erythrocyte lysates and other biological fluids.

Human Hemoglobin Delta (HBd) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hemoglobin Delta elisa. Alternative names of the recognized antigen: Delta-globin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin Delta (HBd) in samples from Serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hemoglobin Delta(HBd)ELISA Kit

QY-E00671 96T
EUR 361

Hemoglobin Delta (HBD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemoglobin Delta (HBd) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Delta (HBD) Antibody

abx233769-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Hemoglobin Delta (HBD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Hemoglobin Delta (HBd)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02042
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemoglobin Delta expressed in: E.coli

Human Hemoglobin Delta (HBd) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hemoglobin Delta (HBd) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Hemoglobin subunit delta, HBD ELISA KIT

ELI-30857h 96 Tests
EUR 824

Human Hemoglobin subunit delta(HBD) ELISA kit

CSB-EL010152HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta (HBD) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hemoglobin subunit delta(HBD) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta(HBD) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human HBd (Hemoglobin Delta)

ELK5336 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Hemoglobin Delta (HBd) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Hemoglobin Delta (HBd) and unlabeled Hemoglobin Delta (HBd) (Standards or samples) wi
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Hemoglobin Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Hemoglobin Delta (HBD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Delta (HBD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd)

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Biotin.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Cy3.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with FITC.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with HRP.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with PE.

Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBd (Met1~Ala143)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC-Cy7.


EF010068 96 Tests
EUR 689

Anti-Human Hemoglobin Antibody [Clone HBD-Q2], Unconjugated-100ug

QDX11-100ug 100ug
EUR 251

Anti-Human Hemoglobin Antibody [Clone HBD-Q7], Unconjugated-100ug

QDX12-100ug 100ug
EUR 251

Human Hemoglobin ELISA Kit

E-80HM 1 x 96 well plate
EUR 441

Hemoglobin (Human) ELISA Kit

EUR 620

HBD antibody

70R-17691 50 ul
EUR 435
Description: Rabbit polyclonal HBD antibody

HBD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HBD. Recognizes HBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HBD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBD. Recognizes HBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human HBD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HBD Recombinant Protein (Human)

RP014431 100 ug Ask for price

Human Hemoglobin (HB)ELISA kit

201-12-2289 96 tests
EUR 440
  • This Hemoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Hemoglobin, Mu ELISA kit

E01H0041-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin, Mu ELISA kit

E01H0041-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin, Mu ELISA kit

E01H0041-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit

E01H0227-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit

E01H0227-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin H ELISA kit

E01H0227-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit

E01H0228-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit

E01H0228-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin A ELISA kit

E01H0228-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit

E01H1362-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit

E01H1362-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human hemoglobin (Hb) ELISA kit

E01H1362-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hemoglobin (HB) ELISA Kit

  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemoglobin (HB) ELISA Kit

abx253149-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Hemoglobin epsilon ELISA KIT|Human

EF010099 96 Tests
EUR 689

Human Hemoglobin (HB) ELISA Kit

CEB409Hu-10x96wellstestplate 10x96-wells test plate
EUR 2754.91
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit

CEB409Hu-1x48wellstestplate 1x48-wells test plate
EUR 314.52
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit

CEB409Hu-1x96wellstestplate 1x96-wells test plate
EUR 406.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit

CEB409Hu-5x96wellstestplate 5x96-wells test plate
EUR 1529.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids.

Human Hemoglobin (HB) ELISA Kit

  • EUR 2805.00
  • EUR 1480.00
  • EUR 407.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hemoglobin elisa. Alternative names of the recognized antigen: Hgb
  • Haemoglobin
  • Heterotetramer(αβ)2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin (HB) in samples from serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Hemoglobin (Hb) ELISA Kit

CSB-E16994h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hemoglobin (Hb) ELISA Kit

  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Hemoglobin

KTE63008-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hemoglobin

KTE63008-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hemoglobin

KTE63008-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Hemoglobin(HB)ELISA Kit

QY-E00680 96T
EUR 361

Human Hemoglobin ELISA Kit (HB)

RK01540 96 Tests
EUR 521

Hemoglobin ELISA Kit (Human) (OKIA00065)

OKIA00065 96 Wells
EUR 648
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.103 ng/ml

HBD Polyclonal Antibody

31684-100ul 100ul
EUR 252

HBD Polyclonal Antibody

31684-50ul 50ul
EUR 187

Anti-HBD Antibody

A01076 100ug/vial
EUR 334

HBD cloning plasmid

CSB-CL010152HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggtgcatctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaacgtggatgcagttggtggtgaggccctgggcagattactggtggtctacccttggacccagaggttctttgagtcctttggggatctgtcctctcctgatgctgttatgggcaaccc
  • Show more
Description: A cloning plasmid for the HBD gene.

HBD Polyclonal Antibody

A59338 100 µg
EUR 570.55
Description: reagents widely cited

HBD Rabbit pAb

A9220-100ul 100 ul
EUR 308

HBD Rabbit pAb

A9220-200ul 200 ul
EUR 459

HBD Rabbit pAb

A9220-20ul 20 ul
EUR 183

HBD Rabbit pAb

A9220-50ul 50 ul
EUR 223

anti- HBD antibody

FNab03769 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: hemoglobin, delta
  • Uniprot ID: P02042
  • Gene ID: 3045
  • Research Area: Cardiovascular
Description: Antibody raised against HBD

Anti-HBD antibody

PAab03769 100 ug
EUR 386

Anti-HBD antibody

STJ113626 100 µl
EUR 277
Description: The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia.

Rat Hemoglobin ELISA Kit

E-25HM 1 x 96 well plate
EUR 441

Dog Hemoglobin ELISA Kit

E-40HM 1 x 96 well plate
EUR 461

Mouse Hemoglobin ELISA Kit

E-90HM 1 x 96 well plate
EUR 441

Hemoglobin (Mouse) ELISA Kit

EUR 620

Rat HbA1C(Glycosylated Hemoglobin/Hemoglobin A1c) ELISA Kit

ER1030 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Alias: HbA1C/Glycosylated Hemoglobin/Hemoglobin A1c
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml

HBD ORF Vector (Human) (pORF)

ORF004811 1.0 ug DNA
EUR 95

Human Hemoglobin H,HbH ELISA Kit

201-12-1181 96 tests
EUR 440
  • This Hemoglobin H ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Hemoglobin C,HbC ELISA Kit

201-12-1182 96 tests
EUR 440
  • This Hemoglobin C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human fetal hemoglobin,HBF ELISA Kit

201-12-1846 96 tests
EUR 440
  • This fetal hemoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human HB (Hemoglobin)

E-EL-H0415 1 plate of 96 wells
EUR 377
  • Gentaur's HB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HB. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HB (Hemoglobin) in samples from Serum, Plasma, Cell supernatant

Human Hemoglobin Beta (HBb) ELISA Kit

DLR-HBb-Hu-48T 48T
EUR 517
  • Should the Human Hemoglobin Beta (HBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Hemoglobin Beta (HBb) in samples from serum, plasma or erythrocyte lysates.

Human Hemoglobin Beta (HBb) ELISA Kit

DLR-HBb-Hu-96T 96T
EUR 673
  • Should the Human Hemoglobin Beta (HBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Hemoglobin Beta (HBb) in samples from serum, plasma or erythrocyte lysates.

Human Glycated hemoglobin A1c ELISA kit

E01G0322-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycated hemoglobin A1c ELISA kit

E01G0322-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycated hemoglobin A1c ELISA kit

E01G0322-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit

E01H0226-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit

E01H0226-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HbF) ELISA kit

E01H0226-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fetal Hemoglobin (HBF) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycated Hemoglobin (HbA1c) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemoglobin beta (HBb) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemoglobin epsilon (HBE) ELISA Kit

abx259278-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Hemoglobin Beta (HBb) ELISA Kit

abx250250-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Hemoglobin C (HbC) ELISA Kit

abx252612-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Fetal Hemoglobin (HBF) ELISA Kit

abx252614-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Hemoglobin H (HbH) ELISA Kit

abx252615-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human HBd(Hemoglobin Delta) ELISA Kit