Human HBd(Hemoglobin Delta) ELISA Kit
Human Hemoglobin Delta (HBd) ELISA Kit |
4-CED092Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Hemoglobin Delta elisa. Alternative names of the recognized antigen: Delta-globin
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin Delta (HBd) in samples from Serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Hemoglobin Delta (HBd) ELISA Kit |
20-abx258328 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Hemoglobin Delta (HBD) Antibody |
20-abx124331 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Hemoglobin Delta (HBD) Antibody |
20-abx112966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hemoglobin Delta (HBd) Antibody |
20-abx129104 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hemoglobin Delta (HBD) Antibody |
abx233769-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Hemoglobin Delta (HBD) Antibody |
20-abx301205 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Hemoglobin Delta (HBd) |
4-RPD092Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P02042
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Hemoglobin Delta expressed in: E.coli |
Human Hemoglobin Delta (HBd) Protein |
20-abx166874 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Hemoglobin Delta (HBd) CLIA Kit |
20-abx490488 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human HBd (Hemoglobin Delta) |
ELK5336 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Hemoglobin Delta (HBd) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Hemoglobin Delta (HBd) and unlabeled Hemoglobin Delta (HBd) (Standards or samples) wi
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Hemoglobin Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Hemoglobin subunit delta, HBD ELISA KIT |
ELI-30857h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Hemoglobin subunit delta(HBD) ELISA kit |
CSB-EL010152HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta (HBD) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Hemoglobin subunit delta(HBD) ELISA kit |
1-CSB-EL010152HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin subunit delta(HBD) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Hemoglobin Delta (HBD) Antibody (HRP) |
20-abx304122 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hemoglobin Delta (HBD) Antibody (FITC) |
20-abx304123 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hemoglobin Delta (HBD) Antibody (Biotin) |
20-abx304124 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hemoglobin Delta (HBd) Polyclonal Antibody (Human) |
4-PAD092Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd) |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC |
4-PAD092Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Biotinylated |
4-PAD092Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Biotin. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), Cy3 |
4-PAD092Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with Cy3. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), FITC |
4-PAD092Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with FITC. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), HRP |
4-PAD092Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with HRP. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), PE |
4-PAD092Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with PE. |
Hemoglobin Delta (HBd) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD092Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HBd (Met1~Ala143)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Hemoglobin Delta (HBd). This antibody is labeled with APC-Cy7. |
Anti-Human Hemoglobin Antibody [Clone HBD-Q2], Unconjugated-100ug |
QDX11-100ug |
EnQuireBio |
100ug |
EUR 251 |
Anti-Human Hemoglobin Antibody [Clone HBD-Q7], Unconjugated-100ug |
QDX12-100ug |
EnQuireBio |
100ug |
EUR 251 |
Hemoglobin (Human) ELISA Kit |
E4738-100 |
Biovision |
|
EUR 620 |
HBD siRNA |
20-abx919125 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HBD antibody |
70R-17691 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HBD antibody |
HBD Antibody |
1-CSB-PA010152GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against HBD. Recognizes HBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HBD Antibody |
1-CSB-PA010152LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HBD. Recognizes HBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human HBD shRNA Plasmid |
20-abx952071 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HBD Recombinant Protein (Human) |
RP014431 |
ABM |
100 ug |
Ask for price |
Human Hemoglobin (HB) ELISA Kit |
CEB409Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 2754.91 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids. |
Human Hemoglobin (HB) ELISA Kit |
CEB409Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 314.52 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids. |
Human Hemoglobin (HB) ELISA Kit |
CEB409Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 406.46 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids. |
Human Hemoglobin (HB) ELISA Kit |
CEB409Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1529.07 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin (HB) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin (HB) in serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids. |
Human Hemoglobin (HB) ELISA Kit |
4-CEB409Hu |
Cloud-Clone |
-
EUR 2805.00
-
EUR 1480.00
-
EUR 407.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Hemoglobin elisa. Alternative names of the recognized antigen: Hgb
- Haemoglobin
- Heterotetramer(αβ)2
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin (HB) in samples from serum, plasma, tissue homogenates, erythrocyte lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Hemoglobin, Mu ELISA kit |
E01H0041-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin, Mu ELISA kit |
E01H0041-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin, Mu ELISA kit |
E01H0041-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hemoglobin, Mu in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin H ELISA kit |
E01H0227-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin H ELISA kit |
E01H0227-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin H ELISA kit |
E01H0227-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin A ELISA kit |
E01H0228-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin A ELISA kit |
E01H0228-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin A ELISA kit |
E01H0228-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hemoglobin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human hemoglobin (Hb) ELISA kit |
E01H1362-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human hemoglobin (Hb) ELISA kit |
E01H1362-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human hemoglobin (Hb) ELISA kit |
E01H1362-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human hemoglobin (Hb) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hemoglobin (HB) ELISA Kit |
20-abx151788 |
Abbexa |
-
EUR 5311.00
-
EUR 2837.00
-
EUR 668.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Hemoglobin (HB) ELISA Kit |
abx253149-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Hemoglobin (HB)ELISA kit |
201-12-2289 |
SunredBio |
96 tests |
EUR 440 |
- This Hemoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Hemoglobin (Hb) ELISA Kit |
CSB-E16994h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Hemoglobin (Hb) ELISA Kit |
1-CSB-E16994h |
Cusabio |
-
EUR 500.00
-
EUR 3402.00
-
EUR 1820.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative competitive ELISA kit for measuring Human Hemoglobin (Hb) in samples from serum, plasma, lysateforRBC. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human Hemoglobin |
KTE63008-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Hemoglobin |
KTE63008-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Hemoglobin |
KTE63008-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Hemoglobin in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Hemoglobin ELISA Kit (HB) |
RK01540 |
Abclonal |
96 Tests |
EUR 521 |
Hemoglobin ELISA Kit (Human) (OKIA00065) |
OKIA00065 |
Aviva Systems Biology |
96 Wells |
EUR 648 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.103 ng/ml |
HBD cloning plasmid |
CSB-CL010152HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 444
- Sequence: atggtgcatctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaacgtggatgcagttggtggtgaggccctgggcagattactggtggtctacccttggacccagaggttctttgagtcctttggggatctgtcctctcctgatgctgttatgggcaaccc
- Show more
|
Description: A cloning plasmid for the HBD gene. |
anti- HBD antibody |
FNab03769 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: hemoglobin, delta
- Uniprot ID: P02042
- Gene ID: 3045
- Research Area: Cardiovascular
|
Description: Antibody raised against HBD |
Anti-HBD Antibody |
A01076 |
BosterBio |
100ug/vial |
EUR 334 |
HBD Polyclonal Antibody |
A59338 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
HBD Rabbit pAb |
A9220-100ul |
Abclonal |
100 ul |
EUR 308 |
HBD Rabbit pAb |
A9220-200ul |
Abclonal |
200 ul |
EUR 459 |
HBD Rabbit pAb |
A9220-20ul |
Abclonal |
20 ul |
EUR 183 |
HBD Rabbit pAb |
A9220-50ul |
Abclonal |
50 ul |
EUR 223 |
HBD Polyclonal Antibody |
31684-100ul |
SAB |
100ul |
EUR 252 |
HBD Polyclonal Antibody |
31684-50ul |
SAB |
50ul |
EUR 187 |
Anti-HBD antibody |
STJ113626 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia. |
Hemoglobin (Mouse) ELISA Kit |
E4739-100 |
Biovision |
|
EUR 620 |
Rat HbA1C(Glycosylated Hemoglobin/Hemoglobin A1c) ELISA Kit |
ER1030 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Alias: HbA1C/Glycosylated Hemoglobin/Hemoglobin A1c
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml |
HBD ORF Vector (Human) (pORF) |
ORF004811 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Fetal Hemoglobin (HBF) ELISA Kit |
CEA996Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids. |
Human Fetal Hemoglobin (HBF) ELISA Kit |
CEA996Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids. |
Human Fetal Hemoglobin (HBF) ELISA Kit |
CEA996Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids. |
Human Fetal Hemoglobin (HBF) ELISA Kit |
CEA996Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fetal Hemoglobin (HBF) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fetal Hemoglobin (HBF) in serum, plasma, erythrocyte lysates and other biological fluids. |
Human Fetal Hemoglobin (HBF) ELISA Kit |
4-CEA996Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Fetal Hemoglobin elisa. Alternative names of the recognized antigen: hemoglobin F
- Foetal Haemoglobin
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Fetal Hemoglobin (HBF) in samples from serum, plasma, erythrocyte lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Hemoglobin Beta (HBb) ELISA Kit |
CED098Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates. |
Human Hemoglobin Beta (HBb) ELISA Kit |
CED098Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates. |
Human Hemoglobin Beta (HBb) ELISA Kit |
CED098Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates. |
Human Hemoglobin Beta (HBb) ELISA Kit |
CED098Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemoglobin Beta (HBb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Hemoglobin Beta (HBb) in serum, plasma and erythrocyte lysates. |
Human Hemoglobin Beta (HBb) ELISA Kit |
4-CED098Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Hemoglobin Beta elisa. Alternative names of the recognized antigen: HB-B
- HBD
- CD113t-C
- Beta Globin
- Spinorphin
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Hemoglobin Beta (HBb) in samples from serum, plasma and erythrocyte lysates with no significant corss-reactivity with analogues from other species. |
Human Hemoglobin Mu (HBM) ELISA Kit |
abx575241-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Glycated hemoglobin A1c ELISA kit |
E01G0322-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glycated hemoglobin A1c ELISA kit |
E01G0322-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glycated hemoglobin A1c ELISA kit |
E01G0322-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glycated hemoglobin A1c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fetal Hemoglobin (HbF) ELISA kit |
E01H0226-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fetal Hemoglobin (HbF) ELISA kit |
E01H0226-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fetal Hemoglobin (HbF) ELISA kit |
E01H0226-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Fetal Hemoglobin (HbF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Hemoglobin (Hb) |
EK0214 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hemoglobin (Hb) in samples from serum, plasma, tissue homogenates and other biological fluids. |
Hemoglobin A1c (HbA1c) (Human) ELISA Kit |
E4656-100 |
Biovision |
|
EUR 805 |
Human HbH(Hemoglobin H) ELISA Kit |
EH3214 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ug/ml
- Alias: HbH
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ug/ml |
Human HBd(Hemoglobin Delta) ELISA Kit