Human SYT7(Synaptotagmin VII) ELISA Kit

Human SYT7(Synaptotagmin VII) ELISA Kit

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
SEH077Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Synaptotagmin VII (SYT7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Synaptotagmin VII (SYT7) in tissue homogenates, cell lysates and other biological fluids.

Human Synaptotagmin VII (SYT7) ELISA Kit
4-SEH077Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Synaptotagmin VII elisa. Alternative names of the recognized antigen: IPCA-7
  • PCANAP7
  • SYT-VII
  • Prostate Cancer Associated Protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Synaptotagmin VII (SYT7) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human SYT7 (Synaptotagmin VII)
ELK5374 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Synaptotagmin VII (SYT7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Synaptota
  • Show more
Description: A sandwich ELISA kit for detection of Synaptotagmin VII from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Synaptotagmin- 7, SYT7 ELISA KIT
ELI-46284h 96 Tests
EUR 824

Human Synaptotagmin 7 (SYT7) ELISA Kit
20-abx258615
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Synaptotagmin- 7, Syt7 ELISA KIT
ELI-18560m 96 Tests
EUR 865

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-48T 48T
EUR 332
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-7 (SYT7)
KTE60438-96T 96T
EUR 539
  • SYT7 is a member of the synaptotagmin gene family and encodes Synaptotagmin-7 similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Synaptotagmin 7 (SYT7) CLIA Kit
20-abx495367
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Synaptotagmin 7 (SYT7) Antibody
abx145710-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
abx027983-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
abx027983-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Synaptotagmin 7 (Syt7) Antibody
abx431984-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Synaptotagmin-7 (Syt7) Antibody
abx445035-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Synaptotagmin 7 (SYT7) Antibody
20-abx212275
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 7 (SYT7) Antibody
20-abx212333
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-48T 48T
EUR 332
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-7 (SYT7)
KTE70308-96T 96T
EUR 539
  • SYT7 is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretio
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-7 (SYT7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Synaptotagmin-7 (Syt7) Antibody (ALP)
abx442432-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (APC)
abx442713-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (Biotin)
abx442993-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (FITC)
abx443273-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (HRP)
abx443554-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (PerCP)
abx444116-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (RPE)
abx444397-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (Streptavidin)
abx444678-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 390)
abx440184-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 488)
abx440465-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 565)
abx440746-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 594)
abx441027-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 633)
abx441308-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 655)
abx441589-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 680)
abx441870-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (ATTO 700)
abx442151-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Synaptotagmin-7 (Syt7) Antibody (PE/ATTO 594)
abx443835-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

SYT7 ELISA Kit (Human) (OKCD01941)
OKCD01941 96 Wells
EUR 831
Description: Description of target: Ca2+ sensor involved in Ca2+-dependent exocytosis of secretory and synaptic vesicles through Ca2+ and phospholipid binding to the C2 domain. Ca2+ induces binding of the C2-domains to phospholipid membranes and to assembled SNARE-complexes; both actions contribute to triggering exocytosis. SYT7 binds Ca2+ with high affinity and slow kinetics compared to other synaptotagmins. Involved in Ca2+-triggered lysosomal exocytosis, a major component of the plasma membrane repair.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

Annexin VII ELISA KIT|Human
EF007788 96 Tests
EUR 689

Synaptotagmin-1 ELISA KIT|Human
EF003387 96 Tests
EUR 689

Synaptotagmin-11 ELISA KIT|Human
EF003388 96 Tests
EUR 689

Synaptotagmin-12 ELISA KIT|Human
EF003389 96 Tests
EUR 689

Synaptotagmin-13 ELISA KIT|Human
EF003390 96 Tests
EUR 689

Synaptotagmin-3 ELISA KIT|Human
EF003391 96 Tests
EUR 689

Synaptotagmin-4 ELISA KIT|Human
EF003392 96 Tests
EUR 689

Synaptotagmin-9 ELISA KIT|Human
EF003393 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

SYT7 siRNA
20-abx935865
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT7 siRNA
20-abx935866
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT7 Antibody
35938-100ul 100ul
EUR 252

SYT7 Antibody
1-CSB-PA592388
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:15-1:50

SYT7 Antibody
1-CSB-PA120806
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT7. Recognizes SYT7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

Human Coagulation Factor VII ELISA kit
E01F0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coagulation Factor VII ELISA kit
E01F0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coagulation Factor VII ELISA kit
E01F0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coagulation Factor VII ELISA kit
E01F0257-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coagulation Factor VII ELISA kit
E01F0257-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coagulation Factor VII ELISA kit
E01F0257-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coagulation Factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen Type VII ELISA kit
E01C0326-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagen Type VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen Type VII ELISA kit
E01C0326-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagen Type VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagen Type VII ELISA kit
E01C0326-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagen Type VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human tissue factor VII ELISA kit
E01T0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human tissue factor VII ELISA kit
E01T0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human tissue factor VII ELISA kit
E01T0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human coagulation factor VII ELISA Kit
ELA-E1874h 96 Tests
EUR 824

Human Copine VII (CPNE7)ELISA Kit
201-12-2911 96 tests
EUR 440
  • This Copine VII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Copine VII(CPNE7)ELISA Kit
QY-E05028 96T
EUR 361

Human SYT7 shRNA Plasmid
20-abx955984
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT7 Recombinant Protein (Human)
RP043903 100 ug Ask for price

Synaptotagmin Cell ELISA Kit
abx595579-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin 1(SYT1) ELISA kit
E01S0428-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Synaptotagmin 1(SYT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Synaptotagmin- 12, SYT12 ELISA KIT
ELI-19047h 96 Tests
EUR 824

Human Synaptotagmin- 16, SYT16 ELISA KIT
ELI-19048h 96 Tests
EUR 824

Human Synaptotagmin- 3, SYT3 ELISA KIT
ELI-52196h 96 Tests
EUR 824

Human Synaptotagmin- 1, SYT1 ELISA KIT
ELI-46277h 96 Tests
EUR 824

Human Synaptotagmin- 14, SYT14 ELISA KIT
ELI-46279h 96 Tests
EUR 824

Human Synaptotagmin- 17, SYT17 ELISA KIT
ELI-46280h 96 Tests
EUR 824

Human Synaptotagmin- 2, SYT2 ELISA KIT
ELI-46281h 96 Tests
EUR 824

Human Synaptotagmin- 4, SYT4 ELISA KIT
ELI-46282h 96 Tests
EUR 824

Human Synaptotagmin- 5, SYT5 ELISA KIT
ELI-46283h 96 Tests
EUR 824

Human Synaptotagmin- 10, SYT10 ELISA KIT
ELI-29331h 96 Tests
EUR 824

Human Synaptotagmin- 8, SYT8 ELISA KIT
ELI-29335h 96 Tests
EUR 824

Human Synaptotagmin- 13, SYT13 ELISA KIT
ELI-29937h 96 Tests
EUR 824

Human Synaptotagmin- 9, SYT9 ELISA KIT
ELI-39805h 96 Tests
EUR 824

Human Synaptotagmin- 11, SYT11 ELISA KIT
ELI-41051h 96 Tests
EUR 824

Human Synaptotagmin- 6, SYT6 ELISA KIT
ELI-41053h 96 Tests
EUR 824

Human Synaptotagmin- 15, SYT15 ELISA KIT
ELI-41700h 96 Tests
EUR 824

Human Synaptotagmin 1 (SYT1) ELISA Kit
20-abx383588
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Synaptotagmin 11 (SYT11) ELISA Kit
abx383589-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 12 (SYT12) ELISA Kit
abx383590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 13 (SYT13) ELISA Kit
abx383591-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 3 (SYT3) ELISA Kit
abx383592-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 4 (SYT4) ELISA Kit
abx383593-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin 9 (SYT9) ELISA Kit
abx383594-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Synaptotagmin II (SYT2)ELISA Kit
201-12-2567 96 tests
EUR 440
  • This Synaptotagmin II ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin III (SYT3)ELISA Kit
201-12-2568 96 tests
EUR 440
  • This Synaptotagmin III ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin IV (SYT4)ELISA Kit
201-12-2569 96 tests
EUR 440
  • This Synaptotagmin IV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin V (SYT5)ELISA Kit
201-12-2570 96 tests
EUR 440
  • This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin VI (SYT6)ELISA Kit
201-12-2571 96 tests
EUR 440
  • This Synaptotagmin VI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin VIII (SYT8)ELISA Kit
201-12-2573 96 tests
EUR 440
  • This Synaptotagmin VIII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XI (SYT11)ELISA Kit
201-12-2574 96 tests
EUR 440
  • This Synaptotagmin XI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XII (SYT12)ELISA Kit
201-12-2575 96 tests
EUR 440
  • This Synaptotagmin XII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XIII (SYT13)ELISA Kit
201-12-2576 96 tests
EUR 440
  • This Synaptotagmin XIII ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XIV (SYT14)ELISA Kit
201-12-2577 96 tests
EUR 440
  • This Synaptotagmin XIV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XV (SYT15)ELISA Kit
201-12-2578 96 tests
EUR 440
  • This Synaptotagmin XV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XVI (SYT16)ELISA Kit
201-12-2579 96 tests
EUR 440
  • This Synaptotagmin XVI ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Synaptotagmin XII(SYT12)ELISA Kit
QY-E01180 96T
EUR 361

Human Synaptotagmin XI(SYT11)ELISA Kit
QY-E01181 96T
EUR 361

Human Synaptotagmin XVI(SYT16)ELISA Kit
QY-E01182 96T
EUR 361

Human Synaptotagmin XV(SYT15)ELISA Kit
QY-E01183 96T
EUR 361

Human Synaptotagmin XIV(SYT14)ELISA Kit
QY-E01184 96T
EUR 361

Human Synaptotagmin XIII(SYT13)ELISA Kit
QY-E01185 96T
EUR 361

Human Synaptotagmin VIII(SYT8)ELISA Kit
QY-E01186 96T
EUR 361

Human Synaptotagmin VI(SYT6)ELISA Kit
QY-E01188 96T
EUR 361

Human Synaptotagmin V(SYT5)ELISA Kit
QY-E01189 96T
EUR 361

Human Synaptotagmin IV(SYT4)ELISA Kit
QY-E01190 96T
EUR 361

Human Synaptotagmin III(SYT3)ELISA Kit
QY-E01191 96T
EUR 413

Human Synaptotagmin II(SYT2)ELISA Kit
QY-E01192 96T
EUR 413

Human Synaptotagmin I(SYT1)ELISA Kit
QY-E01193 96T
EUR 413

SYT7 Conjugated Antibody
C35938 100ul
EUR 397

SYT7 cloning plasmid
CSB-CL023043HU-10ug 10ug
EUR 448
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: ATGTACCGGGACCCGGAGGCGGCCAGCCCAGGGGCGCCCTCGCGCGACGTCCTGCTGGTCTCTGCCATCATCACCGTCAGCCTTAGCGTCACTGTCGTCCTCTGCGGCCTCTGCCACTGGTGTCAGCGCAAACTGGGCAAACGCTACAAGAATTCCTTGGAGACGGTGGGCACGC
  • Show more
Description: A cloning plasmid for the SYT7 gene.

SYT7 Polyclonal Antibody
ES10337-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT7 Polyclonal Antibody
ES10337-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT7 Polyclonal Antibody
ABP60578-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SYT7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT7 from Human, Mouse. This SYT7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT7 protein

SYT7 Polyclonal Antibody
ABP60578-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SYT7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT7 from Human, Mouse. This SYT7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT7 protein

SYT7 Polyclonal Antibody
ABP60578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYT7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT7 from Human, Mouse. This SYT7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT7 protein

SYT7 Rabbit pAb
A12757-100ul 100 ul
EUR 308

SYT7 Rabbit pAb
A12757-200ul 200 ul
EUR 459

SYT7 Rabbit pAb
A12757-20ul 20 ul
EUR 183

SYT7 Rabbit pAb
A12757-50ul 50 ul
EUR 223

Anti-Syt7 antibody
STJ72358 100 µg
EUR 260

Anti-SYT7 antibody
STJ114630 100 µl
EUR 277
Description: This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-SYT7 antibody
STJ191495 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT7

Human Coagulation Factor VII (F7) ELISA Kit
abx575786-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Coagulation factor VII
EK4041 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coagulation factor VII in samples from serum, plasma, tissue homogenates and other biological fluids.

Human F7/ Coagulation factor VII ELISA Kit
E0841Hu 1 Kit
EUR 571

Human F7(Coagulation Factor VII) ELISA Kit
EH3030 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P08709
  • Alias: F7(Coagulation Factor VII)/FVII/Proconvertin/SPCA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Coagulation factor VII, F7 ELISA KIT
ELI-06018h 96 Tests
EUR 824

Human SYT7(Synaptotagmin VII) ELISA Kit