Human CHRD(Chordin) ELISA Kit

Human Chordin (CHRD) ELISA Kit
RDR-CHRD-Hu-96Tests 96 Tests
EUR 756

Human Chordin (CHRD) ELISA Kit
RD-CHRD-Hu-48Tests 48 Tests
EUR 521

Human Chordin (CHRD) ELISA Kit
RD-CHRD-Hu-96Tests 96 Tests
EUR 723

Mouse Chordin (CHRD) ELISA Kit
DLR-CHRD-Mu-48T 48T
EUR 527
  • Should the Mouse Chordin (CHRD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chordin (CHRD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Chordin (CHRD) ELISA Kit
DLR-CHRD-Mu-96T 96T
EUR 688
  • Should the Mouse Chordin (CHRD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chordin (CHRD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Chordin (CHRD) ELISA Kit
DLR-CHRD-Ra-48T 48T
EUR 549
  • Should the Rat Chordin (CHRD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Chordin (CHRD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Chordin (CHRD) ELISA Kit
DLR-CHRD-Ra-96T 96T
EUR 718
  • Should the Rat Chordin (CHRD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Chordin (CHRD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Chordin (CHRD) ELISA Kit
RDR-CHRD-Mu-48Tests 48 Tests
EUR 557

Mouse Chordin (CHRD) ELISA Kit
RDR-CHRD-Mu-96Tests 96 Tests
EUR 774

Rat Chordin (CHRD) ELISA Kit
RDR-CHRD-Ra-48Tests 48 Tests
EUR 583

Rat Chordin (CHRD) ELISA Kit
RDR-CHRD-Ra-96Tests 96 Tests
EUR 811

Mouse Chordin (CHRD) ELISA Kit
RD-CHRD-Mu-48Tests 48 Tests
EUR 533

Mouse Chordin (CHRD) ELISA Kit
RD-CHRD-Mu-96Tests 96 Tests
EUR 740

Rat Chordin (CHRD) ELISA Kit
RD-CHRD-Ra-48Tests 48 Tests
EUR 557

Rat Chordin (CHRD) ELISA Kit
RD-CHRD-Ra-96Tests 96 Tests
EUR 775

Human Chordin(CHRD) ELISA kit
E01C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin(CHRD) ELISA kit
E01C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin(CHRD) ELISA kit
E01C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin (CHRD) ELISA Kit
20-abx258519
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Chordin, CHRD ELISA KIT
ELI-10153h 96 Tests
EUR 824

Human Chordin(CHRD) ELISA kit
CSB-EL005377HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin (CHRD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chordin(CHRD) ELISA kit
1-CSB-EL005377HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin(CHRD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chordin(CHRD)ELISA Kit
QY-E02854 96T
EUR 361

Human Chordin ELISA Kit (CHRD)
RK01111 96 Tests
EUR 521

Human Chordin (CHRD) ELISA Kit
SEC126Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Human Chordin (CHRD) ELISA Kit
SEC126Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Human Chordin (CHRD) ELISA Kit
SEC126Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Human Chordin (CHRD) ELISA Kit
SEC126Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Human Chordin (CHRD) ELISA Kit
4-SEC126Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chordin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chordin (CHRD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Chordin(CHRD) ELISA kit
E02C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chordin(CHRD) ELISA kit
E02C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chordin(CHRD) ELISA kit
E02C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chordin(CHRD) ELISA kit
E03C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chordin(CHRD) ELISA kit
E03C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chordin(CHRD) ELISA kit
E03C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chordin(CHRD) ELISA kit
E06C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chordin(CHRD) ELISA kit
E06C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chordin(CHRD) ELISA kit
E06C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chordin(CHRD) ELISA kit
E04C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chordin(CHRD) ELISA kit
E04C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chordin(CHRD) ELISA kit
E04C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chordin(CHRD) ELISA kit
E07C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chordin(CHRD) ELISA kit
E07C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chordin(CHRD) ELISA kit
E07C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chordin (CHRD) ELISA Kit
20-abx155336
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Chordin(CHRD) ELISA kit
E09C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chordin(CHRD) ELISA kit
E09C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chordin(CHRD) ELISA kit
E09C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chordin(CHRD) ELISA kit
E08C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chordin(CHRD) ELISA kit
E08C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chordin(CHRD) ELISA kit
E08C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chordin, Chrd ELISA KIT
ELI-25485m 96 Tests
EUR 865

Rat Chordin(CHRD)ELISA kit
QY-E10361 96T
EUR 361

Rat Chordin (CHRD) ELISA Kit
SEC126Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Rat Chordin (CHRD) ELISA Kit
SEC126Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Rat Chordin (CHRD) ELISA Kit
SEC126Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Rat Chordin (CHRD) ELISA Kit
SEC126Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Chordin (CHRD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Chordin (CHRD) in serum, plasma, tissue homogenates and other biological fluids.

Rat Chordin (CHRD) ELISA Kit
4-SEC126Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chordin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Chordin (CHRD) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Chordin(CHRD)ELISA kit
QY-E20318 96T
EUR 361

ELISA kit for Human CHRD (Chordin)
ELK5393 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chordin (CHRD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chordin (CHRD). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Chordin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Chordin (CHRD)
KTE62283-48T 48T
EUR 332
  • Chordin is a polypeptide that dorsalizes the developing embryo by binding ventralizing TGF? proteins such as bone morphogenetic proteins. It may also play a role in organogenesis. There are five named isoforms of this protein that are produced by alt
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Chordin (CHRD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Chordin (CHRD)
KTE62283-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Chordin is a polypeptide that dorsalizes the developing embryo by binding ventralizing TGF? proteins such as bone morphogenetic proteins. It may also play a role in organogenesis. There are five named isoforms of this protein that are produced by alt
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Chordin (CHRD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Chordin (CHRD)
KTE62283-96T 96T
EUR 539
  • Chordin is a polypeptide that dorsalizes the developing embryo by binding ventralizing TGF? proteins such as bone morphogenetic proteins. It may also play a role in organogenesis. There are five named isoforms of this protein that are produced by alt
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Chordin (CHRD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Chordin (CHRD) Antibody
abx027851-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chordin (CHRD) Antibody
abx027851-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chordin (CHRD) Antibody
20-abx175857
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chordin (CHRD) Antibody
20-abx100152
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chordin (CHRD) Antibody
20-abx100153
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chordin (CHRD) Antibody
20-abx171735
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chordin (CHRD) Antibody
abx028543-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chordin (CHRD) Antibody
abx028543-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chordin (CHRD) Antibody
20-abx326894
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Chordin (CHRD)
4-RPC126Hu01
  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H2X0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.7kDa
  • Isoelectric Point: 7.5
Description: Recombinant Human Chordin expressed in: E.coli

Recombinant Chordin (CHRD)
4-RPC126Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z0E2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse Chordin expressed in: E.coli

Human Chordin (CHRD) CLIA Kit
20-abx493475
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Chordin (CHRD) Protein
20-abx065887
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Chordin(CHRD) ELISA kit
E05C1699-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chordin(CHRD) ELISA kit
E05C1699-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Chordin(CHRD) ELISA kit
E05C1699-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Chordin(CHRD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat CHRD (Chordin)
ELK6522 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chordin (CHRD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chordin (CHRD). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Chordin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Chordin (CHRD) CLIA Kit
20-abx493476
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Chordin (CHRD) Protein
20-abx065884
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Chordin (CHRD) Protein
20-abx652921
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chordin (CHRD) Polyclonal Antibody (Human)
4-PAC126Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD)

Chordin (CHRD) Polyclonal Antibody (Human), APC
4-PAC126Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with APC.

Chordin (CHRD) Polyclonal Antibody (Human), Biotinylated
4-PAC126Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with Biotin.

Chordin (CHRD) Polyclonal Antibody (Human), Cy3
4-PAC126Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with Cy3.

Chordin (CHRD) Polyclonal Antibody (Human), FITC
4-PAC126Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with FITC.

Chordin (CHRD) Polyclonal Antibody (Human), HRP
4-PAC126Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with HRP.

Chordin (CHRD) Polyclonal Antibody (Human), PE
4-PAC126Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with PE.

Chordin (CHRD) Polyclonal Antibody (Mouse)
4-PAC126Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD)

Chordin (CHRD) Polyclonal Antibody (Human), APC-Cy7
4-PAC126Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Arg700~Leu918)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chordin (CHRD). This antibody is labeled with APC-Cy7.

Chordin (CHRD) Polyclonal Antibody (Mouse), APC
4-PAC126Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with APC.

Chordin (CHRD) Polyclonal Antibody (Mouse), Biotinylated
4-PAC126Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with Biotin.

Chordin (CHRD) Polyclonal Antibody (Mouse), Cy3
4-PAC126Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with Cy3.

Chordin (CHRD) Polyclonal Antibody (Mouse), FITC
4-PAC126Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with FITC.

Chordin (CHRD) Polyclonal Antibody (Mouse), HRP
4-PAC126Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with HRP.

Chordin (CHRD) Polyclonal Antibody (Mouse), PE
4-PAC126Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with PE.

Chordin (CHRD) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC126Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHRD (Ser422~Gly635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chordin (CHRD). This antibody is labeled with APC-Cy7.

Chrd/ Rat Chrd ELISA Kit
ELI-10646r 96 Tests
EUR 886

Chordin
GT15191 100 ug
EUR 526

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

ELISA kit for Mouse Chordin
EK5649 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Chordin in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Chordin PicoKine ELISA Kit
EK2086 96 wells
EUR 425
Description: For quantitative detection of rat Chordin in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Chordin PicoKine ELISA Kit
EK1401 96 wells
EUR 425
Description: For quantitative detection of Mouse Chordin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CHRD Antibody
46495-100ul 100ul
EUR 252

CHRD Antibody
1-CSB-PA875601
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CHRD. Recognizes CHRD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

CHRD siRNA
20-abx911759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHRD siRNA
20-abx911760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Recombinant human Chordin
P1392 100ug Ask for price
  • Uniprot ID: Q9H2X0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Chordin

Human CHRD shRNA Plasmid
20-abx955684
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
DLR-CHRDL1-Hu-48T 48T
EUR 517
  • Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
DLR-CHRDL1-Hu-96T 96T
EUR 673
  • Should the Human Chordin Like Protein 1 (CHRDL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chordin like protein 1(CHRDL1) ELISA kit
E01C1700-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 1(CHRDL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin like protein 1(CHRDL1) ELISA kit
E01C1700-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 1(CHRDL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin like protein 1(CHRDL1) ELISA kit
E01C1700-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 1(CHRDL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin like protein 2(CHRDL2) ELISA kit
E01C1701-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 2(CHRDL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin like protein 2(CHRDL2) ELISA kit
E01C1701-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 2(CHRDL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin like protein 2(CHRDL2) ELISA kit
E01C1701-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chordin like protein 2(CHRDL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
20-abx151058
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Chordin- like protein 2, CHRDL2 ELISA KIT
ELI-10111h 96 Tests
EUR 824

Human Kielin/chordin- like protein, KCP ELISA KIT
ELI-03452h 96 Tests
EUR 824

Human Kielin/chordin-like protein(KCP) ELISA kit
CSB-EL012103HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kielin/chordin-like protein (KCP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Kielin/chordin-like protein(KCP) ELISA kit
1-CSB-EL012103HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kielin/chordin-like protein(KCP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chordin-like protein 1(CHRDL1) ELISA kit
CSB-EL005378HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin-like protein 1 (CHRDL1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chordin-like protein 1(CHRDL1) ELISA kit
1-CSB-EL005378HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin-like protein 1(CHRDL1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chordin-like protein 2(CHRDL2) ELISA kit
CSB-EL005379HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin-like protein 2 (CHRDL2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chordin-like protein 2(CHRDL2) ELISA kit
1-CSB-EL005379HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chordin-like protein 2(CHRDL2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Kielin/Chordin-Like Protein (KCP) ELISA Kit
abx514977-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Chordin- like protein 1, CHRDL1 ELISA KIT
ELI-32330h 96 Tests
EUR 824

Human Chordin Like Protein 1(CHRDL1)ELISA Kit
QY-E02853 96T
EUR 361

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
RDR-CHRDL1-Hu-48Tests 48 Tests
EUR 544

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
RDR-CHRDL1-Hu-96Tests 96 Tests
EUR 756

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
RD-CHRDL1-Hu-48Tests 48 Tests
EUR 521

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
RD-CHRDL1-Hu-96Tests 96 Tests
EUR 723

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
SEF625Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin Like Protein 1 (CHRDL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin Like Protein 1 (CHRDL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
SEF625Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin Like Protein 1 (CHRDL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin Like Protein 1 (CHRDL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
SEF625Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin Like Protein 1 (CHRDL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin Like Protein 1 (CHRDL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
SEF625Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chordin Like Protein 1 (CHRDL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chordin Like Protein 1 (CHRDL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Chordin Like Protein 1 (CHRDL1) ELISA Kit
4-SEF625Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chordin Like Protein 1 elisa. Alternative names of the recognized antigen: NRLN1
  • CHL
  • VOPT
  • Ventroptin
  • Neuralin-1
  • Neurogenesin-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chordin Like Protein 1 (CHRDL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

CHRD Conjugated Antibody
C46495 100ul
EUR 397

CHRD cloning plasmid
CSB-CL005377HU-10ug 10ug
EUR 913
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2868
  • Sequence: ATGCCGAGCCTCCCGGCCCCGCCGGCCCCGCTGCTGCTCCTCGGGCTGCTGCTGCTCGGCTCCCGGCCGGCCCGCGGCGCCGGCCCAGAGCCCCCCGTGCTGCCCATCCGTTCTGAGAAGGAGCCGCTGCCCGTTCGGGGAGCGGCAGGCTGCACCTTCGGCGGGAAGGTCTATG
  • Show more
Description: A cloning plasmid for the CHRD gene.

CHRD Rabbit pAb
A17571-100ul 100 ul
EUR 308

CHRD Rabbit pAb
A17571-200ul 200 ul
EUR 459

CHRD Rabbit pAb
A17571-20ul 20 ul
EUR 183

CHRD Rabbit pAb
A17571-50ul 50 ul
EUR 223

Anti-CHRD antibody
STJ119644 100 µl
EUR 277
Description: This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]

CHRD ORF Vector (Human) (pORF)
ORF012682 1.0 ug DNA
EUR 354

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Human CHRDL1 (Chordin Like Protein 1)
ELK3770 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chordin Like Protein 1 (CHRDL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ch
  • Show more
Description: A sandwich ELISA kit for detection of Chordin Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Chordin Polyclonal Antibody
46873-100ul 100ul
EUR 252

Chordin Polyclonal Antibody
46873-50ul 50ul
EUR 187

Anti-Chordin Antibody
A05363 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Chordin Antibody (CHRD) detection.tested for IHC in Human, Mouse, Rat.

Chordin (chd) Antibody
20-abx319980
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chordin Polyclonal Antibody
ABP58146-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954
  • Applications tips:
Description: A polyclonal antibody for detection of Chordin from Human, Mouse, Rat. This Chordin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954

Chordin Polyclonal Antibody
ABP58146-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954
  • Applications tips:
Description: A polyclonal antibody for detection of Chordin from Human, Mouse, Rat. This Chordin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954

Chordin Polyclonal Antibody
ABP58146-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954
  • Applications tips:
Description: A polyclonal antibody for detection of Chordin from Human, Mouse, Rat. This Chordin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Chordin protein at amino acid sequence of 905-954

Chordin Polyclonal Antibody
ES8754-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Chordin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Chordin Polyclonal Antibody
ES8754-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Chordin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Anti-Chordin antibody
STJ98817 200 µl
EUR 197
Description: Rabbit polyclonal to Chordin.

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Human CHRD(Chordin) ELISA Kit