Human HCK(Hemopoietic Cell Kinase) ELISA Kit
Human Hemopoietic Cell Kinase (HCK) ELISA Kit |
SEC522Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids. |
Human Hemopoietic Cell Kinase (HCK) ELISA Kit |
SEC522Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids. |
Human Hemopoietic Cell Kinase (HCK) ELISA Kit |
4-SEC522Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Hemopoietic Cell Kinase elisa. Alternative names of the recognized antigen: JTK9
- Hematopoietic cell kinase
- p59-HCK/p60-HCK
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hemopoietic Cell Kinase (HCK) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Hemopoietic Cell Kinase (HCK) Antibody |
20-abx112971 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hemopoietic Cell Kinase (HCK) Antibody |
20-abx129152 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hemopoietic Cell Kinase (HCK) Antibody |
20-abx129861 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hemopoietic Cell Kinase (HCK) Antibody |
20-abx270290 |
Abbexa |
-
EUR 495.00
-
EUR 578.00
-
EUR 286.00
-
EUR 885.00
-
EUR 370.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-7 working days.
|
Recombinant Hemopoietic Cell Kinase (HCK) |
4-RPC522Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08631
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 63.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Hemopoietic Cell Kinase expressed in: E.coli |
Recombinant Hemopoietic Cell Kinase (HCK) |
4-RPC522Mu01 |
Cloud-Clone |
-
EUR 499.62
-
EUR 236.00
-
EUR 1598.56
-
EUR 599.52
-
EUR 1099.04
-
EUR 397.00
-
EUR 3846.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08103
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 62.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Hemopoietic Cell Kinase expressed in: E.coli |
Human Hemopoietic Cell Kinase (HCK) Protein |
20-abx166911 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Hemopoietic Cell Kinase (HCK) CLIA Kit |
20-abx496408 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human HCK (Hemopoietic Cell Kinase) |
ELK5594 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hemopoietic Cell Kinase (HCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hemo
- Show more
|
Description: A sandwich ELISA kit for detection of Hemopoietic Cell Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Hemopoietic Cell Kinase (HCK) Protein |
20-abx167380 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2151.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse) |
4-PAC522Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK) |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse) |
4-PAC522Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK) |
Hemopoietic Cell Kinase Phospho-Tyr410 (HCK pY410) Antibody |
20-abx326740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hemopoietic Cell Kinase Phospho-Tyr521 (HCK pY521) Antibody |
20-abx327078 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC |
4-PAC522Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC522Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Cy3 |
4-PAC522Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), FITC |
4-PAC522Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), HRP |
4-PAC522Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), PE |
4-PAC522Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC |
4-PAC522Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC522Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC522Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC522Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC522Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), PE |
4-PAC522Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC522Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro524)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7. |
Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC522Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HCK (Gly2~Pro526)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7. |
Human Tyrosine- protein kinase HCK, HCK ELISA KIT |
ELI-43918h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine HCK(Tyrosine-protein kinase HCK) ELISA Kit |
EB0045 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml |
Mouse Tyrosine- protein kinase HCK, Hck ELISA KIT |
ELI-20432m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Tyrosine Protein Kinase HCK (HCK) ELISA Kit |
abx391445-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Tyrosine Protein Kinase HCK (HCK) ELISA Kit |
abx389525-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Hck ELISA Kit| Rat Tyrosine-protein kinase HCK ELISA Kit |
EF018802 |
Lifescience Market |
96 Tests |
EUR 689 |
Hck ELISA Kit| Mouse Tyrosine-protein kinase HCK ELISA Kit |
EF015159 |
Lifescience Market |
96 Tests |
EUR 689 |
HCK ELISA Kit| Bovine Tyrosine-protein kinase HCK ELISA Kit |
EF010999 |
Lifescience Market |
96 Tests |
EUR 689 |
Tyrosine Protein Kinase HCK (HCK) Antibody |
20-abx214273 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx011842-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx033636-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx033636-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx033637-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx033637-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
20-abx241736 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
20-abx320061 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
abx233785-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
20-abx326808 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK (HCK) Antibody |
20-abx001695 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tyrosine Protein Kinase HCK Phospho-Tyr521 (HCK pY521) Antibody |
20-abx012723 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
HCK ELISA Kit (Human) (OKAN06375) |
OKAN06375 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL |
HCK ELISA Kit (Human) (OKCA01577) |
OKCA01577 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Non-receptor tyrosine-protein kinase found in hematopoietic cells that transmits signals from cell surface receptors and plays an important role in the regulation of innate immune responses, including neutrophil, monocyte, macrophage and mast cell functions, phagocytosis, cell survival and proliferation, cell adhesion and migration. Acts downstream of receptors that bind the Fc region of immunoglobulins, such as FCGR1A and FCGR2A, but also CSF3R, PLAUR, the receptors for IFNG, IL2, IL6 and IL8, and integrins, such as ITGB1 and ITGB2. During the phagocytic process, mediates mobilization of secretory lysosomes, degranulation, and activation of NADPH oxidase to bring about the respiratory burst. Plays a role in the release of inflammatory molecules. Promotes reorganization of the actin cytoskeleton and actin polymerization, formation of podosomes and cell protrusions. Inhibits TP73-mediated transcription activation and TP73-mediated apoptosis. Phosphorylates CBL in response to activation of immunoglobulin gamma Fc region receptors. Phosphorylates ADAM15, BCR, ELMO1, FCGR2A, GAB1, GAB2, RAPGEF1, STAT5B, TP73, VAV1 and WAS.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.69 pg/mL |
HCK ELISA Kit (Human) (OKCD08171) |
OKCD08171 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL |
Human CK-MB ELISA Kit (Creatine Kinase-MB) |
PRB-5047 |
Cell Biolabs |
96 assays |
EUR 572 |
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples. |
Human CK-MB ELISA Kit (Creatine Kinase-MB) |
PRB-5047-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2283 |
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples. |
HCK ELISA Kit (Bovine) (OKWB00108) |
OKWB00108 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DAG Kinase Activity Assay Kit |
MET-5036 |
Cell Biolabs |
50 assays |
EUR 450 |
Checkpoint Kinase Activity Immunoblot Kit |
STA-413 |
Cell Biolabs |
20 assays |
EUR 543 |
Description: Cell Biolabs? Checkpoint Kinase Activity Immunoblot Kit utilizes recombinant Cdc25C as checkpoint kinase substrate. After incubating the substrate with checkpoint kinase samples (such as purified kinase, cell lysate or immunoprecipitate), the phosphorylated Cdc25C is detected by western blot analysis using an anti-phospho-Cdc25C (Ser216). |
HCK protein |
30R-2835 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human HCK protein |
HCK antibody |
70R-17700 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HCK antibody |
HCK Antibody |
32589-100ul |
SAB |
100ul |
EUR 252 |
HCK antibody |
10R-1973 |
Fitzgerald |
100 ul |
EUR 435 |
Description: Mouse monoclonal HCK antibody |
HCK Antibody |
1-CSB-PA002872 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
HCK Antibody |
DF6807 |
Affbiotech |
200ul |
EUR 304 |
Description: HCK Antibody detects endogenous levels of total HCK. |
HCK Antibody |
1-CSB-PA257126 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
HCK Antibody |
1-CSB-PA182384 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100 |
HCK antibody |
70R-33609 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HCK antibody |
HCK Antibody |
BF0453 |
Affbiotech |
200ul |
EUR 376 |
Description: HCK antibody detects endogenous levels of total HCK. |
HCK Antibody |
1-CSB-PA010211ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against HCK. Recognizes HCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
HCK Antibody |
1-CSB-PA010211GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
HCK siRNA |
20-abx902425 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCK siRNA |
20-abx919151 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCK siRNA |
20-abx919152 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCK Antibody |
AF7711 |
Affbiotech |
200ul |
EUR 376 |
Description: HCK Antibody detects endogenous levels of HCK. |
anti-HCK |
YF-PA12264 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to HCK |
anti-HCK |
YF-PA12265 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to HCK |
anti-HCK |
YF-PA12266 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to HCK |
anti-HCK |
YF-PA12267 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to HCK |
CytoSelect BrdU Cell Proliferation ELISA Kit |
CBA-251 |
Cell Biolabs |
96 assays |
EUR 531 |
Description: The CytoSelect BrdU Cell Proliferation ELISA Kit detects BrdU incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody. When cells are incubated in media containing BrdU, the pyrimidine analog is incorporated in place of thymidine into the newly synthesized DNA of proliferating cells. Once the labeling media is removed, the cells are fixed and the DNA is denatured in one step with a fix/denature solution (denaturation of the DNA is necessary to improve the accessibility of the incorporated BrdU for detection). Then an anti-BrdU mouse monoclonal antibody is added followed by an HRP conjugated secondary antibody to detect the incorporated BrdU. The magnitude of the absorbance for the developed color is proportional to the quantity of BrdU incorporated into cells and can be directly correlated to cell proliferation. |
Human HCK shRNA Plasmid |
20-abx952080 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HIF-1 Alpha Cell Based ELISA Kit |
CBA-281 |
Cell Biolabs |
96 assays |
EUR 612 |
Description: Cell Biolabs? HIF-1 Cell Based ELISA Kit is an immunoassay developed for rapid detection of HIF-1 Alpha in fixed cells. Cells on a microplate are stimulated for HIF-1 Alpha stabilization, fixed, permeabilized, and then neutralized in the well. HIF-1 Alpha is then detected with an anti-HIF-1 alpha antibody followed by an HRP conjugated secondary antibody. Each kit provides sufficient reagents to perform up to a total of 96 assays and can detect HIF-1 Alpha from human, mouse, or rat. |
96-well Checkpoint Kinase Activity Assay Kit |
STA-414 |
Cell Biolabs |
96 assays |
EUR 757 |
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors. |
96-well Checkpoint Kinase Activity Assay Kit |
STA-414-5 |
Cell Biolabs |
5 x 96 assays |
EUR 3060 |
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors. |
CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit |
CBA-254 |
Cell Biolabs |
96 assays |
EUR 560 |
Description: Cell Biolabs? CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of PCNA from nuclear and whole cell extracts. The kit detects PCNA from mouse, rat and human, and has a detection sensitivity limit of 12.5 ng/mLPCNA. Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples. |
HCK Rabbit pAb |
A14536-100ul |
Abclonal |
100 ul |
EUR 308 |
HCK Rabbit pAb |
A14536-200ul |
Abclonal |
200 ul |
EUR 459 |
HCK Rabbit pAb |
A14536-20ul |
Abclonal |
20 ul |
EUR 183 |
HCK Rabbit pAb |
A14536-50ul |
Abclonal |
50 ul |
EUR 223 |
HCK Rabbit pAb |
A14537-100ul |
Abclonal |
100 ul |
EUR 308 |
HCK Rabbit pAb |
A14537-200ul |
Abclonal |
200 ul |
EUR 459 |
HCK Rabbit pAb |
A14537-20ul |
Abclonal |
20 ul |
EUR 183 |
HCK Rabbit pAb |
A14537-50ul |
Abclonal |
50 ul |
EUR 223 |
HCK Blocking Peptide |
DF6807-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-Hck Antibody |
A01073 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Hck Antibody (HCK) detection.tested for WB in Human, Mouse, Rat. |
HCK antibody (Tyr521) |
70R-34641 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal HCK antibody (Tyr521) |
HCK antibody (Tyr410) |
70R-33608 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HCK antibody (Tyr410) |
HCK (pY522) Antibody |
20-abx123889 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
HCK Conjugated Antibody |
C32589 |
SAB |
100ul |
EUR 397 |
HCK Blocking Peptide |
BF0453-BP |
Affbiotech |
1mg |
EUR 195 |
HCK (pY521) Antibody |
abx333496-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
HCK Blocking Peptide |
AF7711-BP |
Affbiotech |
1mg |
EUR 195 |
HCK cloning plasmid |
CSB-CL010211HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1518
- Sequence: atggggtgcatgaagtccaagttcctccaggtcggaggcaatacattctcaaaaactgaaaccagcgccagcccacactgtcctgtgtacgtgccggatcccacatccaccatcaagccggggcctaatagccacaacagcaacacaccaggaatcagggaggcaggctctgagg
- Show more
|
Description: A cloning plasmid for the HCK gene. |
Hck Polyclonal Antibody |
ABP51498-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
- Applications tips:
|
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 |
Hck Polyclonal Antibody |
ABP51498-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
- Applications tips:
|
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 |
Hck Polyclonal Antibody |
ABP51498-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
- Applications tips:
|
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 |
HCK Rabbit pAb |
A2083-100ul |
Abclonal |
100 ul |
EUR 308 |
HCK Rabbit pAb |
A2083-200ul |
Abclonal |
200 ul |
EUR 459 |
HCK Rabbit pAb |
A2083-20ul |
Abclonal |
20 ul |
EUR 183 |
HCK Rabbit pAb |
A2083-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- HCK antibody |
FNab03785 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:10 - 1:100
- Immunogen: hemopoietic cell kinase
- Uniprot ID: P08631
- Gene ID: 3055
- Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against HCK |
Hck Polyclonal Antibody |
ES2497-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Hck Polyclonal Antibody |
ES2497-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
anti-HCK (3D12E10) |
LF-MA30143 |
Abfrontier |
100 ul |
EUR 537 |
Description: Mouse Monoclonal to HCK |
Anti-HCK antibody |
STJ116747 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. |
Anti-HCK antibody |
STJ116748 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. |
Anti-HCK antibody |
STJ23924 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. |
Anti-Hck antibody |
STJ93475 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Hck. |
Anti-Hck antibody |
STJ98128 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to Hck. |
Anti-HCK (2A6) |
YF-MA13415 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HCK |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human HCK(Hemopoietic Cell Kinase) ELISA Kit