Human HCK(Hemopoietic Cell Kinase) ELISA Kit

Human HCK(Hemopoietic Cell Kinase) ELISA Kit

Human Hemopoietic Cell Kinase (HCK) ELISA Kit
SEC522Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids.

Human Hemopoietic Cell Kinase (HCK) ELISA Kit
SEC522Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids.

Human Hemopoietic Cell Kinase (HCK) ELISA Kit
4-SEC522Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hemopoietic Cell Kinase elisa. Alternative names of the recognized antigen: JTK9 Hematopoietic cell kinase p59-HCK/p60-HCK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hemopoietic Cell Kinase (HCK) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hemopoietic Cell Kinase (HCK) Antibody
20-abx112971	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hemopoietic Cell Kinase (HCK) Antibody
20-abx129152	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Antibody
20-abx129861	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Antibody
20-abx270290	Abbexa	EUR 495.00 EUR 578.00 EUR 286.00 EUR 885.00 EUR 370.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Recombinant Hemopoietic Cell Kinase (HCK)
4-RPC522Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08631 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Hemopoietic Cell Kinase expressed in: E.coli

Recombinant Hemopoietic Cell Kinase (HCK)
4-RPC522Mu01	Cloud-Clone	EUR 499.62 EUR 236.00 EUR 1598.56 EUR 599.52 EUR 1099.04 EUR 397.00 EUR 3846.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08103 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 62.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hemopoietic Cell Kinase expressed in: E.coli

Human Hemopoietic Cell Kinase (HCK) Protein
20-abx166911	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hemopoietic Cell Kinase (HCK) CLIA Kit
20-abx496408	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human HCK (Hemopoietic Cell Kinase)
ELK5594	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hemopoietic Cell Kinase (HCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hemo Show more
Description: A sandwich ELISA kit for detection of Hemopoietic Cell Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Hemopoietic Cell Kinase (HCK) Protein
20-abx167380	Abbexa	EUR 704.00 EUR 286.00 EUR 2151.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse)
4-PAC522Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK)

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse)
4-PAC522Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK)

Hemopoietic Cell Kinase Phospho-Tyr410 (HCK pY410) Antibody
20-abx326740	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hemopoietic Cell Kinase Phospho-Tyr521 (HCK pY521) Antibody
20-abx327078	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC
4-PAC522Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Biotinylated
4-PAC522Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Cy3
4-PAC522Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), FITC
4-PAC522Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), HRP
4-PAC522Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), PE
4-PAC522Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC
4-PAC522Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC522Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC522Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), FITC
4-PAC522Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), HRP
4-PAC522Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), PE
4-PAC522Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC522Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro524) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC522Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HCK (Gly2~Pro526) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7.

Human Tyrosine- protein kinase HCK, HCK ELISA KIT
ELI-43918h	Lifescience Market	96 Tests	EUR 824

Bovine HCK(Tyrosine-protein kinase HCK) ELISA Kit
EB0045	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml

Mouse Tyrosine- protein kinase HCK, Hck ELISA KIT
ELI-20432m	Lifescience Market	96 Tests	EUR 865

Rat Tyrosine Protein Kinase HCK (HCK) ELISA Kit
abx391445-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Tyrosine Protein Kinase HCK (HCK) ELISA Kit
abx389525-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Hck ELISA Kit| Rat Tyrosine-protein kinase HCK ELISA Kit
EF018802	Lifescience Market	96 Tests	EUR 689

Hck ELISA Kit| Mouse Tyrosine-protein kinase HCK ELISA Kit
EF015159	Lifescience Market	96 Tests	EUR 689

HCK ELISA Kit| Bovine Tyrosine-protein kinase HCK ELISA Kit
EF010999	Lifescience Market	96 Tests	EUR 689

Tyrosine Protein Kinase HCK (HCK) Antibody
20-abx214273	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx011842-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx033636-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx033636-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx033637-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx033637-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
20-abx241736	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
20-abx320061	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
abx233785-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
20-abx326808	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody
20-abx001695	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Hck/ Rat Hck ELISA Kit
ELI-48169r	Lifescience Market	96 Tests	EUR 886

HCK ELISA KIT|Human
EF005093	Lifescience Market	96 Tests	EUR 689

Tyrosine Protein Kinase HCK Phospho-Tyr521 (HCK pY521) Antibody
20-abx012723	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Human CK-MB ELISA Kit (Creatine Kinase-MB)
PRB-5047	Cell Biolabs	96 assays	EUR 572
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples.

Human CK-MB ELISA Kit (Creatine Kinase-MB)
PRB-5047-5	Cell Biolabs	5 x 96 assays	EUR 2283
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DAG Kinase Activity Assay Kit
MET-5036	Cell Biolabs	50 assays	EUR 450

Checkpoint Kinase Activity Immunoblot Kit
STA-413	Cell Biolabs	20 assays	EUR 543
Description: Cell Biolabs? Checkpoint Kinase Activity Immunoblot Kit utilizes recombinant Cdc25C as checkpoint kinase substrate. After incubating the substrate with checkpoint kinase samples (such as purified kinase, cell lysate or immunoprecipitate), the phosphorylated Cdc25C is detected by western blot analysis using an anti-phospho-Cdc25C (Ser216).

HCK protein
30R-2835	Fitzgerald	5 ug	EUR 503
Description: Purified recombinant Human HCK protein

HCK antibody
70R-17700	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HCK antibody

HCK Antibody
32589-100ul	SAB	100ul	EUR 252

HCK antibody
10R-1973	Fitzgerald	100 ul	EUR 435
Description: Mouse monoclonal HCK antibody

HCK Antibody
1-CSB-PA002872	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HCK Antibody
DF6807	Affbiotech	200ul	EUR 304
Description: HCK Antibody detects endogenous levels of total HCK.

HCK Antibody
1-CSB-PA257126	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HCK Antibody
1-CSB-PA182384	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

HCK, Active
7720-5	Biovision		EUR 370

HCK antibody
70R-33609	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HCK antibody

HCK Antibody
BF0453	Affbiotech	200ul	EUR 376
Description: HCK antibody detects endogenous levels of total HCK.

HCK Antibody
1-CSB-PA010211ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HCK. Recognizes HCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HCK Antibody
1-CSB-PA010211GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HCK siRNA
20-abx902425	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HCK siRNA
20-abx919151	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HCK siRNA
20-abx919152	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HCK Antibody
AF7711	Affbiotech	200ul	EUR 376
Description: HCK Antibody detects endogenous levels of HCK.

HCK Antibody
ABD6807	Lifescience Market	100 ug	EUR 438

anti-HCK
YF-PA12264	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HCK

anti-HCK
YF-PA12265	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to HCK

anti-HCK
YF-PA12266	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to HCK

anti-HCK
YF-PA12267	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HCK

CytoSelect BrdU Cell Proliferation ELISA Kit
CBA-251	Cell Biolabs	96 assays	EUR 531
Description: The CytoSelect BrdU Cell Proliferation ELISA Kit detects BrdU incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody.  When cells are incubated in media containing BrdU, the pyrimidine analog is incorporated in place of thymidine into the newly synthesized DNA of proliferating cells.  Once the labeling media is removed, the cells are fixed and the DNA is denatured in one step with a fix/denature solution (denaturation of the DNA is necessary to improve the accessibility of the incorporated BrdU for detection).  Then an anti-BrdU mouse monoclonal antibody is added followed by an HRP conjugated secondary antibody to detect the incorporated BrdU.  The magnitude of the absorbance for the developed color is proportional to the quantity of BrdU incorporated into cells and can be directly correlated to cell proliferation.

Human HCK shRNA Plasmid
20-abx952080	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HIF-1 Alpha Cell Based ELISA Kit
CBA-281	Cell Biolabs	96 assays	EUR 612
Description: Cell Biolabs? HIF-1 Cell Based ELISA Kit is an immunoassay developed for rapid detection of HIF-1 Alpha in fixed cells. Cells on a microplate are stimulated for HIF-1 Alpha stabilization, fixed, permeabilized, and then neutralized in the well. HIF-1 Alpha is then detected with an anti-HIF-1 alpha antibody followed by an HRP conjugated secondary antibody. Each kit provides sufficient reagents to perform up to a total of 96 assays and can detect HIF-1 Alpha from human, mouse, or rat.

96-well Checkpoint Kinase Activity Assay Kit
STA-414	Cell Biolabs	96 assays	EUR 757
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors.

96-well Checkpoint Kinase Activity Assay Kit
STA-414-5	Cell Biolabs	5 x 96 assays	EUR 3060
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors.

CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit
CBA-254	Cell Biolabs	96 assays	EUR 560
Description: Cell Biolabs? CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of PCNA from nuclear and whole cell extracts.  The kit detects PCNA from mouse, rat and human, and has a detection sensitivity limit of 12.5 ng/mLPCNA.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples.

HCK Rabbit pAb
A14536-100ul	Abclonal	100 ul	EUR 308

HCK Rabbit pAb
A14536-200ul	Abclonal	200 ul	EUR 459

HCK Rabbit pAb
A14536-20ul	Abclonal	20 ul	EUR 183

HCK Rabbit pAb
A14536-50ul	Abclonal	50 ul	EUR 223

HCK Rabbit pAb
A14537-100ul	Abclonal	100 ul	EUR 308

HCK Rabbit pAb
A14537-200ul	Abclonal	200 ul	EUR 459

HCK Rabbit pAb
A14537-20ul	Abclonal	20 ul	EUR 183

HCK Rabbit pAb
A14537-50ul	Abclonal	50 ul	EUR 223

HCK Blocking Peptide
DF6807-BP	Affbiotech	1mg	EUR 195

Anti-Hck Antibody
A01073	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Hck Antibody (HCK) detection.tested for WB in Human, Mouse, Rat.

HCK antibody (Tyr521)
70R-34641	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal HCK antibody (Tyr521)

HCK antibody (Tyr410)
70R-33608	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HCK antibody (Tyr410)

HCK (pY522) Antibody
20-abx123889	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

HCK Conjugated Antibody
C32589	SAB	100ul	EUR 397

HCK Blocking Peptide
BF0453-BP	Affbiotech	1mg	EUR 195

HCK (pY521) Antibody
abx333496-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

HCK Blocking Peptide
AF7711-BP	Affbiotech	1mg	EUR 195

HCK cloning plasmid
CSB-CL010211HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1518 Sequence: atggggtgcatgaagtccaagttcctccaggtcggaggcaatacattctcaaaaactgaaaccagcgccagcccacactgtcctgtgtacgtgccggatcccacatccaccatcaagccggggcctaatagccacaacagcaacacaccaggaatcagggaggcaggctctgagg Show more
Description: A cloning plasmid for the HCK gene.

Hck Polyclonal Antibody
ABP51498-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

Hck Polyclonal Antibody
ABP51498-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

Hck Polyclonal Antibody
ABP51498-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410 Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

HCK Rabbit pAb
A2083-100ul	Abclonal	100 ul	EUR 308

HCK Rabbit pAb
A2083-200ul	Abclonal	200 ul	EUR 459

HCK Rabbit pAb
A2083-20ul	Abclonal	20 ul	EUR 183

HCK Rabbit pAb
A2083-50ul	Abclonal	50 ul	EUR 223

anti- HCK antibody
FNab03785	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:10 - 1:100 Immunogen: hemopoietic cell kinase Uniprot ID: P08631 Gene ID: 3055 Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against HCK

Hck Polyclonal Antibody
ES2497-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Hck Polyclonal Antibody
ES2497-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti-HCK (3D12E10)
LF-MA30143	Abfrontier	100 ul	EUR 537
Description: Mouse Monoclonal to HCK

Anti-HCK antibody
PAab03785	Lifescience Market	100 ug	EUR 386

Anti-HCK antibody
STJ116747	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-HCK antibody
STJ116748	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-HCK antibody
STJ23924	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-Hck antibody
STJ93475	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Hck.

Anti-Hck antibody
STJ98128	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Hck.

Anti-HCK (2A6)
YF-MA13415	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HCK

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Adiponectin ELISA Kit
MET-5052	Cell Biolabs	96 assays	EUR 572

Human Adiponectin ELISA Kit
MET-5052-5	Cell Biolabs	5 x 96 assays	EUR 2283

Human Insulin ELISA Kit
MET-5063	Cell Biolabs	96 assays	EUR 572

Human Insulin ELISA Kit
MET-5063-5	Cell Biolabs	5 x 96 assays	EUR 2283

Human HCK(Hemopoietic Cell Kinase) ELISA Kit