Human HCK(Hemopoietic Cell Kinase) ELISA Kit

Human Hemopoietic Cell Kinase (HCK) ELISA Kit

SEC522Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids.

Human Hemopoietic Cell Kinase (HCK) ELISA Kit

SEC522Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hemopoietic Cell Kinase (HCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hemopoietic Cell Kinase (HCK) in serum, plasma, tissue homogenates and other biological fluids.

Human Hemopoietic Cell Kinase (HCK) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hemopoietic Cell Kinase elisa. Alternative names of the recognized antigen: JTK9
  • Hematopoietic cell kinase
  • p59-HCK/p60-HCK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hemopoietic Cell Kinase (HCK) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hemopoietic Cell Kinase (HCK) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopoietic Cell Kinase (HCK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Antibody

  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.

Recombinant Hemopoietic Cell Kinase (HCK)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08631
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopoietic Cell Kinase expressed in: E.coli

Recombinant Hemopoietic Cell Kinase (HCK)

  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08103
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 62.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hemopoietic Cell Kinase expressed in: E.coli

Human Hemopoietic Cell Kinase (HCK) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hemopoietic Cell Kinase (HCK) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HCK (Hemopoietic Cell Kinase)

ELK5594 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hemopoietic Cell Kinase (HCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hemo
  • Show more
Description: A sandwich ELISA kit for detection of Hemopoietic Cell Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Hemopoietic Cell Kinase (HCK) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2151.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK)

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK)

Hemopoietic Cell Kinase Phospho-Tyr410 (HCK pY410) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopoietic Cell Kinase Phospho-Tyr521 (HCK pY521) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Biotin.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with Cy3.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with FITC.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with HRP.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with PE.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro524)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7.

Hemopoietic Cell Kinase (HCK) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HCK (Gly2~Pro526)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hemopoietic Cell Kinase (HCK). This antibody is labeled with APC-Cy7.

Human Tyrosine- protein kinase HCK, HCK ELISA KIT

ELI-43918h 96 Tests
EUR 824

Bovine HCK(Tyrosine-protein kinase HCK) ELISA Kit

EB0045 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml

Mouse Tyrosine- protein kinase HCK, Hck ELISA KIT

ELI-20432m 96 Tests
EUR 865

Rat Tyrosine Protein Kinase HCK (HCK) ELISA Kit

abx391445-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tyrosine Protein Kinase HCK (HCK) ELISA Kit

abx389525-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Hck ELISA Kit| Rat Tyrosine-protein kinase HCK ELISA Kit

EF018802 96 Tests
EUR 689

Hck ELISA Kit| Mouse Tyrosine-protein kinase HCK ELISA Kit

EF015159 96 Tests
EUR 689

HCK ELISA Kit| Bovine Tyrosine-protein kinase HCK ELISA Kit

EF010999 96 Tests
EUR 689

Tyrosine Protein Kinase HCK (HCK) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx011842-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx033636-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx033636-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx033637-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx033637-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

abx233785-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine Protein Kinase HCK (HCK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hck/ Rat Hck ELISA Kit

ELI-48169r 96 Tests
EUR 886


EF005093 96 Tests
EUR 689

Tyrosine Protein Kinase HCK Phospho-Tyr521 (HCK pY521) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

HCK ELISA Kit (Human) (OKAN06375)

OKAN06375 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

HCK ELISA Kit (Human) (OKCA01577)

OKCA01577 96 Wells
EUR 846
Description: Description of target: Non-receptor tyrosine-protein kinase found in hematopoietic cells that transmits signals from cell surface receptors and plays an important role in the regulation of innate immune responses, including neutrophil, monocyte, macrophage and mast cell functions, phagocytosis, cell survival and proliferation, cell adhesion and migration. Acts downstream of receptors that bind the Fc region of immunoglobulins, such as FCGR1A and FCGR2A, but also CSF3R, PLAUR, the receptors for IFNG, IL2, IL6 and IL8, and integrins, such as ITGB1 and ITGB2. During the phagocytic process, mediates mobilization of secretory lysosomes, degranulation, and activation of NADPH oxidase to bring about the respiratory burst. Plays a role in the release of inflammatory molecules. Promotes reorganization of the actin cytoskeleton and actin polymerization, formation of podosomes and cell protrusions. Inhibits TP73-mediated transcription activation and TP73-mediated apoptosis. Phosphorylates CBL in response to activation of immunoglobulin gamma Fc region receptors. Phosphorylates ADAM15, BCR, ELMO1, FCGR2A, GAB1, GAB2, RAPGEF1, STAT5B, TP73, VAV1 and WAS.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.69 pg/mL

HCK ELISA Kit (Human) (OKCD08171)

OKCD08171 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

Human CK-MB ELISA Kit (Creatine Kinase-MB)

PRB-5047 96 assays
EUR 572
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples.

Human CK-MB ELISA Kit (Creatine Kinase-MB)

PRB-5047-5 5 x 96 assays
EUR 2283
Description: Our Human CK-MB ELISA Kit specifically detects the CK-MB form of Creatine Kinase in serum or plasma samples as well as in lysates. The kit does not detect the CK-MM or CK-BB isotypes. Each kit provides sufficient reagents for 96 wells including standards and unknown samples.

HCK ELISA Kit (Bovine) (OKWB00108)

OKWB00108 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

DAG Kinase Activity Assay Kit

MET-5036 50 assays
EUR 450

Checkpoint Kinase Activity Immunoblot Kit

STA-413 20 assays
EUR 543
Description: Cell Biolabs? Checkpoint Kinase Activity Immunoblot Kit utilizes recombinant Cdc25C as checkpoint kinase substrate. After incubating the substrate with checkpoint kinase samples (such as purified kinase, cell lysate or immunoprecipitate), the phosphorylated Cdc25C is detected by western blot analysis using an anti-phospho-Cdc25C (Ser216).

HCK protein

30R-2835 5 ug
EUR 503
Description: Purified recombinant Human HCK protein

HCK antibody

70R-17700 50 ul
EUR 435
Description: Rabbit polyclonal HCK antibody

HCK Antibody

32589-100ul 100ul
EUR 252

HCK antibody

10R-1973 100 ul
EUR 435
Description: Mouse monoclonal HCK antibody

HCK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

HCK Antibody

DF6807 200ul
EUR 304
Description: HCK Antibody detects endogenous levels of total HCK.

HCK Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

HCK Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

HCK, Active

EUR 370

HCK antibody

70R-33609 100 ug
EUR 327
Description: Rabbit polyclonal HCK antibody

HCK Antibody

BF0453 200ul
EUR 376
Description: HCK antibody detects endogenous levels of total HCK.

HCK Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HCK. Recognizes HCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HCK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HCK. Recognizes HCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HCK Antibody

AF7711 200ul
EUR 376
Description: HCK Antibody detects endogenous levels of HCK.

HCK Antibody

ABD6807 100 ug
EUR 438


YF-PA12264 50 ul
EUR 363
Description: Mouse polyclonal to HCK


YF-PA12265 50 ug
EUR 363
Description: Mouse polyclonal to HCK


YF-PA12266 100 ul
EUR 403
Description: Rabbit polyclonal to HCK


YF-PA12267 100 ug
EUR 403
Description: Rabbit polyclonal to HCK

CytoSelect BrdU Cell Proliferation ELISA Kit

CBA-251 96 assays
EUR 531
Description: The CytoSelect BrdU Cell Proliferation ELISA Kit detects BrdU incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody.  When cells are incubated in media containing BrdU, the pyrimidine analog is incorporated in place of thymidine into the newly synthesized DNA of proliferating cells.  Once the labeling media is removed, the cells are fixed and the DNA is denatured in one step with a fix/denature solution (denaturation of the DNA is necessary to improve the accessibility of the incorporated BrdU for detection).  Then an anti-BrdU mouse monoclonal antibody is added followed by an HRP conjugated secondary antibody to detect the incorporated BrdU.  The magnitude of the absorbance for the developed color is proportional to the quantity of BrdU incorporated into cells and can be directly correlated to cell proliferation.

Human HCK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HIF-1 Alpha Cell Based ELISA Kit

CBA-281 96 assays
EUR 612
Description: Cell Biolabs? HIF-1 Cell Based ELISA Kit is an immunoassay developed for rapid detection of HIF-1 Alpha in fixed cells. Cells on a microplate are stimulated for HIF-1 Alpha stabilization, fixed, permeabilized, and then neutralized in the well. HIF-1 Alpha is then detected with an anti-HIF-1 alpha antibody followed by an HRP conjugated secondary antibody. Each kit provides sufficient reagents to perform up to a total of 96 assays and can detect HIF-1 Alpha from human, mouse, or rat.

96-well Checkpoint Kinase Activity Assay Kit

STA-414 96 assays
EUR 757
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors.

96-well Checkpoint Kinase Activity Assay Kit

STA-414-5 5 x 96 assays
EUR 3060
Description: Our 96-well Checkpoint Kinase Activity Assay Kit provides a non-isotopic, sensitive and specific method to monitor checkpoint kinase activity using its physiological substrate; it can also be used in screening checkpoint kinase inhibitors.

CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit

CBA-254 96 assays
EUR 560
Description: Cell Biolabs? CytoSelect Proliferating Cell Nuclear Antigen (PCNA) ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of PCNA from nuclear and whole cell extracts.  The kit detects PCNA from mouse, rat and human, and has a detection sensitivity limit of 12.5 ng/mLPCNA.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples. 

HCK Rabbit pAb

A14536-100ul 100 ul
EUR 308

HCK Rabbit pAb

A14536-200ul 200 ul
EUR 459

HCK Rabbit pAb

A14536-20ul 20 ul
EUR 183

HCK Rabbit pAb

A14536-50ul 50 ul
EUR 223

HCK Rabbit pAb

A14537-100ul 100 ul
EUR 308

HCK Rabbit pAb

A14537-200ul 200 ul
EUR 459

HCK Rabbit pAb

A14537-20ul 20 ul
EUR 183

HCK Rabbit pAb

A14537-50ul 50 ul
EUR 223

HCK Blocking Peptide

DF6807-BP 1mg
EUR 195

Anti-Hck Antibody

A01073 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Hck Antibody (HCK) detection.tested for WB in Human, Mouse, Rat.

HCK antibody (Tyr521)

70R-34641 100 ug
EUR 327
Description: Purified Rabbit polyclonal HCK antibody (Tyr521)

HCK antibody (Tyr410)

70R-33608 100 ug
EUR 327
Description: Rabbit polyclonal HCK antibody (Tyr410)

HCK (pY522) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

HCK Conjugated Antibody

C32589 100ul
EUR 397

HCK Blocking Peptide

BF0453-BP 1mg
EUR 195

HCK (pY521) Antibody

abx333496-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

HCK Blocking Peptide

AF7711-BP 1mg
EUR 195

HCK cloning plasmid

CSB-CL010211HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggtgcatgaagtccaagttcctccaggtcggaggcaatacattctcaaaaactgaaaccagcgccagcccacactgtcctgtgtacgtgccggatcccacatccaccatcaagccggggcctaatagccacaacagcaacacaccaggaatcagggaggcaggctctgagg
  • Show more
Description: A cloning plasmid for the HCK gene.

Hck Polyclonal Antibody

ABP51498-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
  • Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

Hck Polyclonal Antibody

ABP51498-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
  • Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

Hck Polyclonal Antibody

ABP51498-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Hck around the non-phosphorylation site of Y410
  • Applications tips:
Description: A polyclonal antibody for detection of Hck from Human, Mouse, Rat. This Hck antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Hck around the non-phosphorylation site of Y410

HCK Rabbit pAb

A2083-100ul 100 ul
EUR 308

HCK Rabbit pAb

A2083-200ul 200 ul
EUR 459

HCK Rabbit pAb

A2083-20ul 20 ul
EUR 183

HCK Rabbit pAb

A2083-50ul 50 ul
EUR 223

anti- HCK antibody

FNab03785 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: hemopoietic cell kinase
  • Uniprot ID: P08631
  • Gene ID: 3055
  • Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against HCK

Hck Polyclonal Antibody

ES2497-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Hck Polyclonal Antibody

ES2497-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Hck from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti-HCK (3D12E10)

LF-MA30143 100 ul
EUR 537
Description: Mouse Monoclonal to HCK

Anti-HCK antibody

PAab03785 100 ug
EUR 386

Anti-HCK antibody

STJ116747 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-HCK antibody

STJ116748 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-HCK antibody

STJ23924 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon.

Anti-Hck antibody

STJ93475 200 µl
EUR 197
Description: Rabbit polyclonal to Hck.

Anti-Hck antibody

STJ98128 100 µl
EUR 234
Description: Mouse monoclonal to Hck.

Anti-HCK (2A6)

YF-MA13415 100 ug
EUR 363
Description: Mouse monoclonal to HCK

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human HCK(Hemopoietic Cell Kinase) ELISA Kit