Human FUT2(Fucosyltransferase 2) ELISA Kit

Human Fucosyltransferase 2(FUT2)ELISA Kit

QY-E00554 96T
EUR 361

Human Fucosyltransferase 2 (FUT2) ELISA Kit

SEF192Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 2 (FUT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 2 (FUT2) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 2 (FUT2) ELISA Kit

SEF192Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 2 (FUT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 2 (FUT2) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 2 (FUT2) ELISA Kit

SEF192Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 2 (FUT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 2 (FUT2) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 2 (FUT2) ELISA Kit

SEF192Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 2 (FUT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 2 (FUT2) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 2 (FUT2) ELISA Kit

4-SEF192Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fucosyltransferase 2 elisa. Alternative names of the recognized antigen: SE
  • Se2
  • Sej
  • Secretor Status Included
  • Galactoside 2-Alpha-L-Fucosyltransferase 2
  • Secretor blood group alpha-2-fucosyltransferase
  • Secretor factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fucosyltransferase 2 (FUT2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human FUT2 (Fucosyltransferase 2)

ELK5600 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fucosyltransferase 2 (FUT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fucosy
  • Show more
Description: A sandwich ELISA kit for detection of Fucosyltransferase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Fucosyltransferase 2 (FUT2) Antibody

20-abx006308
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fucosyltransferase 2 (FUT2) Antibody

20-abx322947
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucosyltransferase 2 (FUT2) Antibody

20-abx215482
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fucosyltransferase 2 (FUT2) Antibody

abx432718-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human Fucosyltransferase 2 (FUT2) CLIA Kit

20-abx496407
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E01G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E01G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E01G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E06G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E06G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E06G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E02G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E02G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E02G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E03G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E03G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E03G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E04G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E04G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E04G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E08G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E08G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E08G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E07G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E07G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E07G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E09G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E09G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E09G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E05G0410-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E05G0410-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) ELISA kit

E05G0410-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Galactoside 2 Alpha L fucosyltransferase 2(FUT2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FUT2 ELISA KIT

ELI-47357h 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Rabbit FUT2 ELISA KIT

ELI-13153Ra 96 Tests
EUR 928

Porcine FUT2 ELISA KIT

ELI-26613p 96 Tests
EUR 928

Rat Fut2 ELISA KIT

ELI-07810r 96 Tests
EUR 886

Bovine FUT2 ELISA KIT

ELI-07917b 96 Tests
EUR 928

Mouse Fut2 ELISA KIT

ELI-47358m 96 Tests
EUR 865

Human Protein O-Fucosyltransferase 2 (POFUT2) ELISA Kit

abx382338-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein O-Fucosyltransferase 2(POFUT2)ELISA Kit

QY-E03886 96T
EUR 361

FUT2 siRNA

20-abx902033
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUT2 Antibody

ABD9523 100 ug
EUR 438

FUT2 siRNA

20-abx917313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUT2 siRNA

20-abx917314
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUT2 Antibody

45985-100ul 100ul
EUR 252

FUT2 Antibody

45985-50ul 50ul
EUR 187

FUT2 Antibody

DF9523 200ul
EUR 304
Description: FUT2 Antibody detects endogenous levels of total FUT2.

FUT2 Antibody

1-CSB-PA008506
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FUT2. Recognizes FUT2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

anti-FUT2

YF-PA11877 100 ul
EUR 403
Description: Rabbit polyclonal to FUT2

FUT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0822403 1.0 ug DNA
EUR 154

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Fucosyltransferase 3 (FUT3) ELISA Kit

abx571346-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Fucosyltransferase 6, FUT6 ELISA Kit

ELA-E0358h 96 Tests
EUR 824

Human Fucosyltransferase 3 (FUT3) ELISA Kit

20-abx151599
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

20-abx151600
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

20-abx151601
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

abx251785-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

abx253826-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

DLR-FUT3-Hu-48T 48T
EUR 479
  • Should the Human Fucosyltransferase 3 (FUT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 3 (FUT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

DLR-FUT3-Hu-96T 96T
EUR 621
  • Should the Human Fucosyltransferase 3 (FUT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 3 (FUT3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

DLR-FUT4-Hu-48T 48T
EUR 498
  • Should the Human Fucosyltransferase 4 (FUT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 4 (FUT4) in samples from tissue homogenates or other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

DLR-FUT4-Hu-96T 96T
EUR 647
  • Should the Human Fucosyltransferase 4 (FUT4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 4 (FUT4) in samples from tissue homogenates or other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

DLR-FUT6-Hu-48T 48T
EUR 517
  • Should the Human Fucosyltransferase 6 (FUT6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 6 (FUT6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

DLR-FUT6-Hu-96T 96T
EUR 673
  • Should the Human Fucosyltransferase 6 (FUT6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fucosyltransferase 6 (FUT6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

SEA944Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 3 (FUT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 3 (FUT3) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

SEA944Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 3 (FUT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 3 (FUT3) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

SEA944Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 3 (FUT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 3 (FUT3) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

SEA944Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 3 (FUT3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 3 (FUT3) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 3 (FUT3) ELISA Kit

4-SEA944Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fucosyltransferase 3 elisa. Alternative names of the recognized antigen: CD174
  • FUT3
  • FT3B
  • LE
  • Les
  • FucT-III
  • Lewis FT
  • Galactoside 3(4)-L-Fucosyltransferase, Lewis Blood Group
  • Blood group Lewis alpha-4-fucosyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fucosyltransferase 3 (FUT3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

SEB059Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 4 (FUT4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 4 (FUT4) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

SEB059Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 4 (FUT4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 4 (FUT4) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

SEB059Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 4 (FUT4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 4 (FUT4) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

SEB059Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 4 (FUT4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 4 (FUT4) in tissue homogenates, cell lysates and other biological fluids.

Human Fucosyltransferase 4 (FUT4) ELISA Kit

4-SEB059Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fucosyltransferase 4 elisa. Alternative names of the recognized antigen: CD15
  • 3FAL
  • FCT3A, ELFT, SSEA-1, LeX
  • Lewis x
  • Stage Specific Embryonic Antigen 1
  • 3-Fucosyl-N-Acetyl Lactosamine
  • Alpha(1, 3)Fucosyltransferase, Myeloid-Specific
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fucosyltransferase 4 (FUT4) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Fucosyltransferase 3 ELISA Kit (FUT3)

RK01427 96 Tests
EUR 521

Human Fucosyltransferase 3 (FUT3) ELISA Kit

RD-FUT3-Hu-48Tests 48 Tests
EUR 478

Human Fucosyltransferase 3 (FUT3) ELISA Kit

RD-FUT3-Hu-96Tests 96 Tests
EUR 662

Human Fucosyltransferase 4 (FUT4) ELISA Kit

RD-FUT4-Hu-48Tests 48 Tests
EUR 500

Human Fucosyltransferase 4 (FUT4) ELISA Kit

RD-FUT4-Hu-96Tests 96 Tests
EUR 692

Human Fucosyltransferase 6 (FUT6) ELISA Kit

RD-FUT6-Hu-48Tests 48 Tests
EUR 521

Human Fucosyltransferase 6 (FUT6) ELISA Kit

RD-FUT6-Hu-96Tests 96 Tests
EUR 723

Human Fucosyltransferase 3 (FUT3) ELISA Kit

RDR-FUT3-Hu-48Tests 48 Tests
EUR 500

Human Fucosyltransferase 3 (FUT3) ELISA Kit

RDR-FUT3-Hu-96Tests 96 Tests
EUR 692

Human Fucosyltransferase 4 (FUT4) ELISA Kit

RDR-FUT4-Hu-48Tests 48 Tests
EUR 522

Human Fucosyltransferase 4 (FUT4) ELISA Kit

RDR-FUT4-Hu-96Tests 96 Tests
EUR 724

Human Fucosyltransferase 6 (FUT6) ELISA Kit

RDR-FUT6-Hu-48Tests 48 Tests
EUR 544

Human Fucosyltransferase 6 (FUT6) ELISA Kit

RDR-FUT6-Hu-96Tests 96 Tests
EUR 756

Human Fucosyltransferase 9(FUT9)ELISA Kit

QY-E00547 96T
EUR 413

Human Fucosyltransferase 8(FUT8)ELISA Kit

QY-E00548 96T
EUR 361

Human Fucosyltransferase 7(FUT7)ELISA Kit

QY-E00549 96T
EUR 361

Human Fucosyltransferase 6(FUT6)ELISA Kit

QY-E00550 96T
EUR 361

Human Fucosyltransferase 5(FUT5)ELISA Kit

QY-E00551 96T
EUR 361

Human Fucosyltransferase 4(FUT4)ELISA Kit

QY-E00552 96T
EUR 361

Human Fucosyltransferase 3(FUT3)ELISA Kit

QY-E00553 96T
EUR 361

Human Fucosyltransferase 11(FUT11)ELISA Kit

QY-E00555 96T
EUR 361

Human Fucosyltransferase 10(FUT10)ELISA Kit

QY-E00556 96T
EUR 361

Human Fucosyltransferase 1(FUT1)ELISA Kit

QY-E00557 96T
EUR 361

Human Fucosyltransferase 6 (FUT6) ELISA Kit

SEF196Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 6 (FUT6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 6 (FUT6) in serum, plasma, tissue homogenates and other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

SEF196Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 6 (FUT6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 6 (FUT6) in serum, plasma, tissue homogenates and other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

SEF196Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 6 (FUT6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 6 (FUT6) in serum, plasma, tissue homogenates and other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

SEF196Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fucosyltransferase 6 (FUT6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fucosyltransferase 6 (FUT6) in serum, plasma, tissue homogenates and other biological fluids.

Human Fucosyltransferase 6 (FUT6) ELISA Kit

4-SEF196Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fucosyltransferase 6 elisa. Alternative names of the recognized antigen: FT1A
  • FCT3A
  • FucT-VI
  • Alpha-(1, 3)-Fucosyltransferase
  • Galactoside 3-L-Fucosyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fucosyltransferase 6 (FUT6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human FUT2 shRNA Plasmid

20-abx951669
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FUT2 Recombinant Protein (Human)

RP012667 100 ug Ask for price

FUT2 Recombinant Protein (Human)

RP039322 100 ug Ask for price

Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) ELISA kit

E01G0409-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) ELISA kit

E01G0409-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) ELISA kit

E01G0409-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galactoside 2 Alpha L fucosyltransferase 1(FUT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FUT2 Conjugated Antibody

C45985 100ul
EUR 397

FUT2 cloning plasmid

CSB-CL606050HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atgctggtcgttcagatgcctttctcctttcccatggcccacttcatcctctttgtctttacggtttccactatatttcacgttcagcagcggctagcgaagattcaagccatgtgggagttaccggtgcagataccagtgctagcctcaacatcaaaggcactgggacccagcca
  • Show more
Description: A cloning plasmid for the FUT2 gene.

FUT2 cloning plasmid

CSB-CL606050HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1032
  • Sequence: ATGCTGGTCGTTCAGATGCCTTTCTCCTTTCCCATGGCCCACTTCATCCTCTTTGTCTTTACGGTTTCCACTATATTTCACGTTCAGCAGCGGCTAGCGAAGATTCAAGCCATGTGGGAGTTACCGGTGCAGATACCAGTGCTAGCCTCAACATCAAAGGCACTGGGACCCAGCC
  • Show more
Description: A cloning plasmid for the FUT2 gene.

FUT2 Polyclonal Antibody

ES5411-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FUT2 from Human. This antibody is tested and validated for IHC, WB, ELISA

FUT2 Polyclonal Antibody

ES5411-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FUT2 from Human. This antibody is tested and validated for IHC, WB, ELISA

FUT2 Polyclonal Antibody

ABP54412-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human FUT2
  • Applications tips:
Description: A polyclonal antibody for detection of FUT2 from Human. This FUT2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human FUT2

FUT2 Polyclonal Antibody

ABP54412-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human FUT2
  • Applications tips:
Description: A polyclonal antibody for detection of FUT2 from Human. This FUT2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human FUT2

FUT2 Polyclonal Antibody

ABP54412-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human FUT2
  • Applications tips:
Description: A polyclonal antibody for detection of FUT2 from Human. This FUT2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human FUT2

FUT2 Rabbit pAb

A5721-100ul 100 ul
EUR 308

FUT2 Rabbit pAb

A5721-200ul 200 ul
EUR 459

FUT2 Rabbit pAb

A5721-20ul 20 ul
EUR 183

FUT2 Rabbit pAb

A5721-50ul 50 ul
EUR 223

FUT2 Blocking Peptide

DF9523-BP 1mg
EUR 195

Anti-FUT2 antibody

STJ72602 100 µg
EUR 359

Anti-FUT2 antibody

STJ93166 200 µl
EUR 197
Description: Rabbit polyclonal to FUT2.

Anti-FUT2 antibody

STJ28288 100 µl
EUR 277
Description: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene.

Anti-FUT2 (4C12)

YF-MA10360 100 ug
EUR 363
Description: Mouse monoclonal to FUT2

Human FUT2(Fucosyltransferase 2) ELISA Kit